Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof

A pathogenic bacteria, positive technology, applied in the field of biotechnology detection, can solve the problems of poor domestic reagents, rare detection methods, invalid detection results, etc., to avoid false negative results, high degree of automation, and improved sensitivity.

Active Publication Date: 2016-09-21
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In the prior art, the method for single detection of pathogens is very common, but the detection method capable of simultaneously detecting the above four pathogens is very rare. The existing patent publication number is CN101560557, which discloses a gene solution for joint detection of five severe pathogens Phase chip and its non-diagnostic detection method, using gene liquid chip detection to simultaneously detect five pathogens of Bacillus anthracis, Yersinia pestis, Francisella tularensis, Brucella and Burkholderia pseudomallei
During the detection process, 5 kinds of coded microspheres need to be coupled with capture probes. The microspheres need to be washed and activated, and the operation is complicated. Sometimes the coupling fails, which will lead to invalid subsequent detection results and waste manpower and material resources.
In addition, the suspension chip detection system used is detected by two laser beams, red and green. The red laser excites the dye in the microsphere matrix to identify the number of the microsphere, and the green laser identifies the fluorescent dye bound to the surface. Expensive, the reagents EDC and streptavidin-phycoerythrin used need imported reagents, domestic reagents are not effective, and the instruments are not available in ordinary testing units. When using a hemocytometer to count the number of microspheres, a high-magnification microbial microscope is required , when detecting fluorescence, a suspension chip detector is required, so the use of gene liquid phase chips to detect these pathogens has great limitations. Therefore, a detection reagent that can detect these pathogens at the same time is needed, and the detection reagents are easy to obtain, which is suitable for existing Detection reagents and detection methods that can be achieved by all units

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof
  • Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof
  • Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] The design of embodiment 1 primer, probe

[0056] Firstly, the specific target genes of the four pathogenic bacteria were screened separately. According to the purpose of detection, multiple pathogenic bacterial gene sequences were downloaded from GenBank for each pathogen, compared and analyzed, and the conserved region was selected, and Array Designer4.0 software was used to assist in the design of amplification primers and suitable Hybridization probe for fluorescent quantitative PCR reaction system.

[0057] Since the present invention is a multiplex fluorescence quantification, the selection of probe labels is more critical at first, and secondly, the probes designed by the software must be screened, and the probe signals of the four genes cannot interfere with each other, so it is necessary to consider four pairs of genes when designing the probes. The primers and the four probes cannot interfere with each other.

[0058] Fluorescent quantitative PCR detection is...

Embodiment 2

[0082] Example 2 Detection of Four Pathogenic Bacteria of Yersinia pestis, Tularemia, Burkholderia pseudomallei and Brucella by Common PCR

[0083] According to Example 1, the conserved sequence of the Pla gene fragment of Yersinia pestis was screened, and a pair of oligonucleotide sequences (primers) and probes were designed. It was finally determined that the size of the Yersinia pestis primer amplified fragment was 113bp, and the nucleotide sequence was shown in SEQ ID No.4.

[0084] SEQ ID No. 4: atgtcacacc taatgccaaa gtctttgcgg aatttacata cagtaaatatgatgagggca aaggaggtac tcagatcatt gataagaata gtggagattc tgtctctatt ggc.

[0085] The ISFtu gene was selected for the tularensis, and the size of the fragment amplified by the primers was 113bp, and the nucleotide sequence was shown in SEQ ID No.8.

[0086] SEQ ID No. 8: agctacttta ctatcatgag ttttaccttc tgacaacaat atttctattggattacctaaagcatcagtc atagcatgga ttttagtggt tatcccacca actgatctac caa.

[0087] Burkholderia pseudomallei ...

Embodiment 3

[0096] Example 3 Fluorescence quantitative PCR detection kit for four kinds of pathogenic bacteria

[0097] Fluorescent quantitative PCR detection kit for four pathogens of Yersinia pestis, Tularemia, Burkholderia pseudomallei and Brucella include the following components:

[0098] Premix EX Taq™×2;

[0099] The upstream primer sequence of Yersinia pestis is shown in SEQ ID No.1, the downstream primer sequence is shown in SEQ ID No.2, the probe sequence is shown in SEQ ID No.3, and 5 of the probe SEQ IDNo.3 'marks FAM, 3' marks BHQ1;

[0100] The upstream primer sequence of the tularemia is shown in SEQ ID No.5, the downstream primer sequence is shown in SEQ ID No.6, and the probe sequence is shown in SEQ ID No.7 wherein, the probe SEQ ID No.7 The 5' tag Texred, 3' tag BHQ2;

[0101] The upstream primer sequence of the Burkholderia pseudomallei is shown in SEQ ID No.9, the downstream primer sequence is shown in SEQ ID No.10, and the probe sequence is shown in SEQ ID No.11, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a kit for simultaneously detecting four pathogenic bacteria Yersinia pestis, Frencisella tularensis, Burkholderia pseudomallei and Brucella by using fluorescent quantitative PCR (polymerase chain reaction) and a non-diagnostic detection method. The kit comprises specific primers and probes corresponding to the four pathogenic bacteria. The kit disclosed by the invention is convenient to use, and has the advantages of low reagent consumption, low cost, high detection specificity and high sensitivity. The detection method can detect four pathogenic bacteria for one sample, thereby greatly simplifying the operational process, reducing the repetitive operation steps, saving the time, reducing the labor consumed by repetitive operation, effectively saving the cost and implementing quick screening.

Description

technical field [0001] The invention belongs to the field of biotechnology detection, and in particular relates to a kit for simultaneously detecting four pathogenic bacteria of Yersinia pestis, Tularemia, Burkholderia pseudomallei and Brucella and a non-diagnostic detection method thereof. Background technique [0002] Yersinia pestis (Yersinia pestis) is a Gram-negative short bacillus, which is the pathogenic bacterium of plague, and the transmission of plague in animals and humans is mainly carried out by rat fleas. When the rat flea sucks the blood containing the pathogen, the bacteria multiply in the stomach of the flea, and when the flea inhales the blood again, the pathogen is brought into the animal or human body. Flea feces also contain Yersinia pestis, which can enter the skin due to itching. This "rat → flea → human" transmission mode is the main transmission mode of plague. A small number of patients can be infected by direct contact with pollutants from patient...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/10C12Q1/04C12N15/11C12R1/01
CPCC12Q1/6851C12Q1/689C12Q2600/16C12Q2531/113C12Q2537/143C12Q2563/107
Inventor杨宇王静张志华吉尚志赵婷婷王建成
OwnerCHINESE ACAD OF INSPECTION & QUARANTINE