Cultivation method of Cyp gene knocked-out rats, and preparation method of liver microsome of the rats

A gene knockout, liver microsome technology, applied in the field of biomedicine, can solve the problems of chemical inhibitors and inhibitory antibodies with reduced selectivity and specificity, inability to predict well, and inability to make accurate judgments, etc.

Active Publication Date: 2016-11-23
EAST CHINA NORMAL UNIV
View PDF1 Cites 47 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This screening method has a huge workload, and if there are many metabolic pathways of the drug, it is impossible to make an accurate judgment
In addition, studies have shown that due to species differences, rat CYP enzymes may have certain differences from humans in terms of expression and activity, resulting in a greatly reduced selectivity and specificity of chemical inhibitors and inhibitory antibodies
Therefore, the chemical inhibitors used in the above studies have different inhibitory effects on rats and humans, and the results obtained in rats cannot predict the situation in humans very well.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cultivation method of Cyp gene knocked-out rats, and preparation method of liver microsome of the rats
  • Cultivation method of Cyp gene knocked-out rats, and preparation method of liver microsome of the rats
  • Cultivation method of Cyp gene knocked-out rats, and preparation method of liver microsome of the rats

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1 Target Design and GuideRNA Synthesis

[0071] The CRISPR / Cas gene knockout system can recognize the DNA sequence ending with NGG corresponding to its guide RNA in the genome, so the selected target of the present invention is a 18bp nucleotide at the 5' end of the NGG sequence in the rat target gene acid sequence; because the CRISPR / Cas system for gene knockout utilizes: the introduction of mutated bases in DNA in non-homologous recombination repair, which causes frameshift mutations in the 3' end sequence behind the mutated site, and in order to Therefore, the principle of designing the target in the present invention is to be as close as possible to the 5' end of the full length of the gene; and because the target sequence designed in the present invention is only 18 bp, the same gene may exist in the rat genome. or similar sequences, so the target designed in the present invention will perform online prediction of off-target effects. The prediction tool use...

Embodiment 2

[0076] Example 2 Synthesis and transcription of sgRNA template

[0077] In order to achieve higher efficiency knockout of target genes in rat fertilized eggs, the present invention uses rat fertilized eggs to co-inject sgRNA and Cas9mRNA. The present invention first synthesizes a 60bp oligonucleotide sequence comprising a T7 promoter sequence and a target sequence; then, a complete sgRNA template sequence is synthesized by overlapping PCR, with a total length of 130bp; the template sequence is synthesized by a T7 in vitro transcription kit Perform in vitro transcription; after extraction with phenol-chloroform, the co-transcription product of the purified target and -sgRNA ligated by overlapping PCR was obtained. The corresponding oligonucleotide sequence of 60bp synthesized by the present invention is as follows:

[0078] Cyp2e1

[0079] GATCACTAATACGACTCACTATAGG AAGCAGATCTATAACAGT GTTTTAGAGCTAGAAAT (SEQ ID NO. 4)

[0080] Cyp3a1

[0081] GATCACTAATACGACTCACTATAGG CAA...

Embodiment 3

[0085] Example 3 Genotype Identification of Cyp Gene Knockout Rats

[0086] In the present invention, offspring rats produced by pseudopregnant mother rats are defined as the F0 generation, and the F0 generation rats are mated with wild-type rats, and the offspring rats produced are defined as the F1 generation. Through genotype identification, the present invention selects heterozygous rats with a single locus deletion in the F1 generation, and the number of missing bases is not an integer multiple of three (that is, two alleles at the same locus, one is a base deletion , one is normal) to perform self-crossing, and define its offspring as F2. Since the F1 generation is heterozygous selfing, the genotypes of the F2 generation may be homozygous wild-type rats, homozygous base deletion rats, and heterozygous rats, and the three types of rats produced in this way have closer Genetic background and smaller individual differences facilitate follow-up research.

[0087]Identifica...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a cultivation method of Cyp gene knocked-out rats, and a preparation method of liver microsome of the rats. The Cyp gene knock-out herein includes Cyp single gene knock-out and Cyp multiple gene knock-out. In the method, firstly a Cyp gene knocked-out rat is constructed by means of a CRISPR / Cas system, which includes selection of a knocked-out target site, in-vitro synthesis and transcription of sg RNA and Cas9m RNA, preparation of a pseudopregnant female rat, in-vitro micro-injection and transplanting of a single-cell embryo, and cultivation of the rat, and finally, a homozygote Cyp gene knocked-out rat can be cultured. Furthermore, the liver of the Cyp gene knocked-out rat is extracted and is subjected to homogenization and differential centrifugation to prepare the liver microsome of the rat in Cyp gene deletion. The invention also provides an application of the Cyp gene knocked-out rats and the liver microsome thereof in study on drug metabolism.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a method for cultivating drug-metabolizing cytochrome P450 (CYP) enzyme-deficient rats, that is, Cyp gene knockout rats, and a preparation method for liver microsomes. Background technique [0002] The marketing of a new drug usually goes through a long process, generally divided into the research stage and the development stage, which mainly includes the process of target establishment, compound activity screening, lead compound optimization, preclinical research and clinical research. Statistics show that 40% of drugs in clinical research were forced to terminate the research due to their poor pharmacokinetic properties. Therefore, evaluating the metabolic and pharmacokinetic properties of compounds at the early stage of compound screening is beneficial to reduce the investment and risk of failure in later research, among which drug screening based on cytochrome P450 enzyme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/89C12N15/53C12N15/55C12N15/11C12N5/10A01K67/027A61K49/00
Inventor王昕刘明耀李大力汤玉鲁健李咏梅
OwnerEAST CHINA NORMAL UNIV