Encoding gene of keratinase and recombination expression and application thereof
A technology of keratinase and coding gene, which is applied in the field of keratinase, can solve problems such as differences, and achieve good tolerance, good degradation effect, and high hair removal efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Cloning method and gene sequence analysis of embodiment 1 keratinase gene
[0030] Bacillus parabrevus Brevibacillus parabrevis (preserved on May 11, 2015 in the General Microbiology Center of the Chinese Microbiological Culture Collection Management Committee, Institute of Microbiology, Chinese Academy of Sciences, and the preservation number is CGMCC No.10798) was cultured in liquid LB medium for 12 hours , 8000rpm centrifugation for 2min to collect the bacterial cells, wash the bacterial cells with sterile water, and extract the total DNA using the instructions of the Bacterial Genomic DNA Extraction Kit (Shanghai Jierui Bioengineering Co., Ltd.).
[0031] Using primer F-bp (CGC GGATCC GATGTGCGTGAAAAAGAAAAAT) and R-bp (CCC AAGCTT GTTAGAAGCCGCTTGAAC), using the total DNA of Bacillus parabrevibacillus parabrevis CGMCC10798 as a template, the keratinase gene was amplified by PCR. The reaction conditions were pre-denaturation at 95°C for 3 minutes and then cycled: de...
Embodiment 2
[0032] The construction of embodiment 2 keratinase expression system
[0033] Taking the pET-22b(+) vector and Escherichia coli as examples, the construction process of the keratinase expression system is illustrated. Using primers F-bp and R-bp to amplify the gene encoding keratinase KerBP, the pET-22b(+) plasmid and pMD 19T-kerbp keratinase gene were double-digested with BamH I and Hind III respectively, and the enzyme-digested The product was run on agarose gel electrophoresis, the target band was recovered by tapping the gel, ligated overnight at 16°C with T4 ligase, the ligated product was transformed into E.coli JM109 competent cells, and the transformed product was spread on LB (Amp) solid medium plate. Cultivate overnight at 37°C, pick a single colony, insert it into LB (Amp) liquid medium, and extract the plasmid after culturing at 37°C for 8 hours to obtain the pET-22b(+)-kerbp plasmid ( figure 1 and figure 2 ).
[0034] The plasmid pET-22b(+)-kerbp was heat-shocke...
Embodiment 3
[0035] The purification of embodiment 3 recombinant keratinases
[0036] Centrifuge the fermented liquid at 4°C and 10,000rpm for 30 minutes to collect the crude enzyme liquid, filter through a 0.22 μm microporous membrane to remove impurities, and slowly add ammonium sulfate powder to the supernatant to make the concentration reach 70% saturation (w / v), Salt out overnight; centrifuge at 4°C and 10,000rpm for 30min, take the precipitate and dissolve it in an appropriate amount of buffer containing 20mM Tris-HCl buffer (pH 8.0), 500mM NaCl, and 10mM imidazole, dialyze in this buffer overnight, and filter through 0.4μm Membrane filter the sample to get the loading sample. Utilize the AKTA protein purification instrument to adopt the nickel ion affinity column, respectively use the loading buffer (A liquid): 20mM Tris-HCl buffer (pH 8.0), 500mM NaCl, 10mM imidazole, 6M guanidine hydrochloride; Elution buffer (B Solution): 20mM Tris-HCl buffer (pH8.0), 500mM NaCl, 500mM imidazole...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Apparent molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


