Phalaenopsis flowering gene PhalLFY and application thereof
A phalaenopsis and gene technology, applied in the fields of molecular biology and genetic engineering, can solve the problems of early flowering and functional changes, and achieve the effect of great economic value and wide application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0034] Example 1:
[0035] 1. Cloning and homology analysis of the PhalLFY gene of Phalaenopsis.
[0036] (1) Flower buds of Phalaenopsis hybrida cv. Wedding Promenade were used as experimental materials, and the materials were grown under normal conditions in the greenhouse (12h / 12h; 25-28°C).
[0037] (2) RNA extraction: Trizol reagent (purchased from Invitrogen) was used to extract the total RNA of the test materials. The whole operation process was strictly in accordance with the RNA extraction process description of the Trizol reagent, and then the total RNA was used as a template to reverse transcribe to obtain the first cDNA. chain.
[0038] (3) Cloning of the gene: using the first strand of reverse-transcribed Phalaenopsis flower bud cDNA as a template, PCR amplification was performed using primers LFY-F and LFY-R, the PCR product was recovered, sequenced, and a core fragment of 600 bp was obtained.
[0039] LFY-F:5'-CGGAYATIAAYAARCCIAARATGMGICAYTA-3'
[0040] LFY-R...
Example Embodiment
[0047] Example 2
[0048] Analysis of Gene Expression Patterns of Flowering Gene PhalLFY in Phalaenopsis
[0049] In Phalaenopsis vegetative growth period and reproductive growth period, get the root, stem, leaf of vegetative growth period and the root, stem, leaf and pedicel organ of reproductive growth period, extract the total RNA of these organs respectively with Trizol reagent (Invitrogen), Quantitatively remove 2 μg RNA after measuring OD260, and then use oligo-dT primer and PrimeScript TM ReverseTranscriptase (purchased from Takara Company) carried out reverse transcription reaction (method reference manual), with specific primers LF: 5'-ATCCCCGCCTCTCAATCT-3' and LR: 5'-TCTCATCCGCACCAGTTC-3'. PCR amplification was carried out, and the reaction product was 1.0% Agarose gel electrophoresis separation, the electrophoresis results are as follows figure 2 and 3 Shown, PhalLFY gene is all expressed in each organ of Phalaenopsis, and in the vegetative growth stage, the ex...
Example Embodiment
[0050] Example 3
[0051] Expression of Phalaenopsis PhalLFY gene in Arabidopsis and phenotypic identification of transgenic plants.
[0052] (1) Construction of expression vector containing target gene PhalLFY
[0053] Design primer PhLFYF 5'AATTCTAGAATGGACCCAAGCGACGCCTTCTCC3'
[0054] PhLFYR 5'CATGGATCCCTAAAGCATGGAAGGAGGGATTCC3'
[0055] Using the cDNA of the Phalaenopsis flower bud as a template, using PhLFYF and PhLFYR as primers to amplify the Phalaenopsis PhalLFY gene with restriction sites XbaI and BamH I, connected to the PMD18-T vector of Takara, and then according to J. Sambrook et al. "Molecular Cloning Experiment Guide" for transformation and identification. The identified positive plasmid utilizes restriction site Xba I and EcoR I to excise the PhalLFY gene from the T vector, and connects it with the plant expression vector pBI121 with 35s promoter and nos terminator after digestion with XbaI and EcoR I, An expression vector pBI121-35s-PhalLFY was constructed ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap