Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetic engineering strain used for producing 2-hydroxyphenazine and preparation method and application genetic engineering strain

A technology of genetically engineered strains and hydroxyphenazine, applied in the field of genetic engineering, can solve the problems of bacteriostatic effect of 2-hydroxyphenazine, obstacles to industrial application of metabolic regulation, low synthesis efficiency, and inability to achieve large-scale production, and achieves good Potential for industrial application, short fermentation cycle, simple effect of nutritional requirements

Inactive Publication Date: 2017-05-10
SHANGHAI JIAO TONG UNIV
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, studies have found that the current Pseudomonas chloropinus strains that can secrete 2-hydroxyphenazine have low synthesis efficiency and cannot achieve large-scale production. Industrial applications, etc. have created obstacles

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering strain used for producing 2-hydroxyphenazine and preparation method and application genetic engineering strain
  • Genetic engineering strain used for producing 2-hydroxyphenazine and preparation method and application genetic engineering strain
  • Genetic engineering strain used for producing 2-hydroxyphenazine and preparation method and application genetic engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] This embodiment relates to a method for preparing a genetically engineered strain for producing 2-hydroxyphenazine, comprising the following steps:

[0045] Primers F2 (5'GGTACCGAGATAAACATGCTTTGAAGTGC 3', such as SEQ ID NO.9) and R2 (5'CTATTTGGCGTTGAGCCCCCACCATA 3', such as SEQ ID NO.10) were designed according to the phzO sequence in the genome of Pseudomonas chloropinus GP72, and amplified by PCR phzO gene and purified;

[0046] Primers were designed according to the upstream and downstream sequences of the phzH gene in the genome of Pseudomonas chloropinus HT66. The upstream primer is F1 (5'ACATGATTACGAATTAGCCGCTGTTGGGTAAAGG 3', such as SEQ ID NO.7) and R1 (5'GTTTATCTCGGTACCTCAGGGTTGCAAACGCC3', such as SEQ ID NO.8), and the downstream primer is F3 (5'CTCAACGCCAAATAGTACGAGCCTGAGGGAGCCACGGCAG 3', such as SEQ ID NO. 11) and R3 (5'CGACTCTAGAGGATCATGGCCGAACCACCCTTGC 3', such as SEQ ID NO.12), use the genomic DNA as a template to amplify the corresponding fragment in the ...

Embodiment 2

[0052] This embodiment relates to the comparison of the synthesis of phenazine compounds by different Pseudomonas aeruginosa. The specific steps are:

[0053] Take 1.5mL of each of the fermentation broths of three kinds of Pseudomonas aeruginosa GP72, HT66 and HT66-O into a 5mL centrifuge tube, first adjust the pH value to 2.0 with 6N HCl, then shake and extract with an equal volume of ethyl acetate, and then The mixture was centrifuged at 10,000×g for 10 min, the organic phase was taken into a new centrifuge tube, and 1 / 10 volume of deionized water was added, shaken and allowed to stand for stratification. Finally, the organic phase was concentrated to dryness under reduced pressure, and the product was fully dissolved in methanol and then analyzed by high pressure liquid chromatography (HPLC).

[0054] HPLC detection conditions: detection wavelength 254nm, C18 reverse phase column, flow rate 1mL / min, column temperature 30°C. Mobile phase: the aqueous phase is 5mM ammonium a...

Embodiment 3

[0059] This embodiment relates to the synthesis of 2-hydroxyphenazine by Pseudomonas chloropinus genetically engineered bacteria. The specific steps are:

[0060] Fully activate Pseudomonas chloropinus HT66 and HT66-O on the solid KB plate respectively, then pick a ring and inoculate it into a vial containing 5mL KB liquid medium, and culture it at 28°C and 180rpm on a shaker 12 hours; then inoculated into a 250mL Erlenmeyer flask filled with 50mL KB liquid medium according to the proportion of 1%, and fermented and cultivated under the conditions of 28°C and 180rpm. Regularly sample, measure the optical density value at wavelength 600nm place with spectrophotometer, i.e. OD600, in order to represent bacterial growth situation, and draw the growth curve of bacterial strain (such as Figure 4 ). The results showed that after the gene phzH was replaced by phzO, the growth of the strain did not change significantly, which was beneficial to continue to synthesize phenazine compou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic engineering strain used for producing 2-hydroxyphenazine and a preparation method and application of the genetic engineering strain. The genetic engineering strain is prepared through the following step of replacing a phzH gene in a genome of Pseudomonas chlororaphis HT66 CCTCCNO: M2013467 and a derivative with an exogenous phzO gene. The preparation method comprises the following steps of constructing a recombinant plasmid, hybridizing parents and screening a gene replaced mutant strain. The high-level phenazine synthesis capability of the strain HT66 is utilized, the phzH gene in the strain HT66 is replaced with the exogenous phzO gene, the high-concentration phenazine-1-carboxylic acid is taken as a substrate, and is further transformed into 2-hydroxyphenazine under the action of a phzO protein. The genetic engineering strain is high in stability, produces less by-products, is short in fermentation period, and is favorable for the industrialized production of 2-hydroxyphenazine.

Description

technical field [0001] The invention relates to a genetic engineering bacterial strain for producing 2-hydroxyphenazine, a preparation method and application thereof, and belongs to the technical field of genetic engineering. Background technique [0002] Phenazine derivatives are a class of nitrogen-containing heterocyclic compounds. They generally have certain colors and specific absorption spectra. This is due to the presence of different substituents on the heterocyclic rings, which determine their different physical and chemical properties and inhibit plant growth. and biological activity of animal pathogens. Almost all phenazine compounds have biocontrol activity against bacteria and fungi. Phenazine compounds have a certain redox activity, and may act as electron carriers in cells. When cells undergo redox reactions, they transfer electrons to target cells, resulting in the increase of oxygen free radicals in superoxide in target cells and cell death. [0003] Natur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/63C12P17/12C12R1/38
CPCC07K14/21C12P17/12
Inventor 彭华松张雪洪江耀祖
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com