Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for improving content of intracellular oxidation type coenzymes I

An internal oxidation and coenzyme technology, applied in the field of cofactor engineering, can solve the problems of low coenzyme content and inability to enhance the efficiency of related catalytic reactions, and achieve the effect of increasing the content of NAD+, improving the efficiency, and expanding the flux of the metabolic network.

Active Publication Date: 2017-05-10
JIANGNAN UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the coenzyme content in its cells is low and cannot play a role in enhancing the efficiency of related catalytic reactions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving content of intracellular oxidation type coenzymes I
  • Method for improving content of intracellular oxidation type coenzymes I
  • Method for improving content of intracellular oxidation type coenzymes I

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] (1) Construction of expression plasmids for overexpression genes pncA, pncB, nadC, nadD, nadE:

[0026] According to the sequence of the gene pncA (Gene ID: 946276), the sequence of the gene pncB (Gene ID: 8182321), the sequence of the gene nadC (Gene ID: 948869), the sequence of the gene nadD (Gene ID: 8180157) in Escherichia coli reported on NCBI ), the sequence of gene nadE (Gene ID: 8179982) designed upstream and downstream primers, and synthesized primers with BamH I and XhoI restriction sites:

[0027] pncA-F:GGATCCATGCCCCCTCGCGCCCTGTT

[0028] pncA-R: CCGCTCGAGTTACCCCTGTGTCTCTTCCCAGTCTG

[0029] pncB-F:CGCGGATCCATGACACAATTCGCTTCT

[0030] pncB-R:CCGCTCGAGTTAACTGGCTTTTTTAATATGCGG

[0031] nadC-F: GGATCCATGCCGCCTCGCCGCTATAACC

[0032] nadC-R:CTCGAGTTAGCGAAAACGCATTGAAAGGTCGAGTG

[0033] nadD-F:CGCGGATCCATGAAATCTTTACAGGCTC

[0034] nadD-R: CCGCTCGAGTCAGCGATACAAGCCTTGTT

[0035] nadE-F:CGCGGATCCATGACATTGCAACAACAAAT

[0036] nadE-R:CCGCTCGAGTTACTTTTTCCAGAAATCAT...

Embodiment 2

[0044] (1) Construction of Escherichia coli recombinant strains co-expressing multiple genes:

[0045] Design upstream and downstream primers based on the successfully constructed plasmids pET-21a-pncA, pET-21a-pncB, pET-21a-nadC, pET-21a-nadD, pET-21a-nadE, and add On the SD-AS sequence (AGAAGGAGATATACA), the overlapping extension PCR technology is used to realize the tandem expression of multiple genes on the same plasmid.

[0046] Synthesize primers with BamH I and Xho I restriction sites, using plasmids pET-21a-pncA, pET-21a-pncB, pET-21a-nadC, pET-21a-nadD, pET-21a-nadE as templates, overlapping The target genes pncA-pncB, pncA-nadD, pncA-nadE, pncB-nadD, pncB-nadE, nadD-nadE, nadC-nadD, nadC-nadE and pncA-pncB-nadD, pncA-nadD- nadE, pncB-nadD-nadE, nadC-nadD-nadE, pncA-pncB-nadE fragments, the reaction conditions are: pre-denaturation at 98°C for 30s; denaturation at 98°C for 10s; annealing at 60°C for 15s; extension at 72°C for 112s, 80s, and 90s, respectively . 10mi...

Embodiment 3

[0054] (1) Preparation of functional factor promoter: tryptophan, aspartic acid, quinolinic acid, nicotinic acid, and nicotinamide were respectively dissolved in sterilized ultrapure water to prepare a solution with a final concentration of 100 mg / L.

[0055] (2) The initial strain E.coli BL21 / pET-21a was fermented and cultured in a 50ml shake flask for aerobic fermentation. Transfer 1% of the inoculum from the cryopreservation tube into a 5mL LB test tube, and at the same time add ampicillin with a final concentration of 100μg / mL, culture for 12 hours, then transfer to 50mL of LB fermentation medium at 1% of the inoculum Add functional factor promoters with a final concentration of 40mg / L, and culture at 37°C and 200r / min until OD 600 When it is 0.6-2.0, add IPTG with a final concentration of 0.1-10mmol / L, induce at 16-37°C, 200r / min.

[0056] 3. Determination of intracellular NAD in the initial strain E.coli BL21 / pET-21a cultured by adding different precursor substances + ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the content of intracellular oxidation type coenzymes I, and belongs to the technical field of cofactor engineering. The method mainly aims at the NAD<+> in escherichia coli for synthesizing a plurality of key genes of the NAD<+> through co-expression; meanwhile, different precursor substances are added in the aerobic fermentation process of the recombination strains; the content of the intracellular oxidation type coenzymes I of the escherichia coli is improved. Therefore the content of the intracellular NAD<+> reaches the maximum value. The ideal and the scheme are provided for solving the problems to efficiently utilize substrates, increase the target products, improve the NAD (H) relay type biological catalysis reaction efficiency and the like.

Description

technical field [0001] The invention relates to a method for increasing the content of intracellular oxidized coenzyme I, which belongs to the technical field of cofactor engineering. Background technique [0002] Coenzyme I, also known as nicotinamide adenine dinucleotide (nicotinamide adenine dinucleotide), is a coenzyme that transfers electrons (hydrogen ions), and the KEGG database shows NADH / NAD + As an important cofactor, it participates in more than 740 metabolic reactions in microbial cells, including redox reactions, energy metabolism processes, regulation of gene expression, and maintenance of Ca + Homeostasis and regulation of cell aging, etc., especially in glycolysis, gluconeogenesis, tricarboxylic acid cycle and respiratory chain play an irreplaceable role. NAD + It can provide energy and redox power for various reactions in the metabolic network, and its concentration can regulate the metabolic network pathway, increase the metabolic flux, improve the biocat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12P19/36C12R1/19
Inventor 穆晓清徐岩
Owner JIANGNAN UNIV