Method for improving content of intracellular oxidation type coenzymes I
An internal oxidation and coenzyme technology, applied in the field of cofactor engineering, can solve the problems of low coenzyme content and inability to enhance the efficiency of related catalytic reactions, and achieve the effect of increasing the content of NAD+, improving the efficiency, and expanding the flux of the metabolic network.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] (1) Construction of expression plasmids for overexpression genes pncA, pncB, nadC, nadD, nadE:
[0026] According to the sequence of the gene pncA (Gene ID: 946276), the sequence of the gene pncB (Gene ID: 8182321), the sequence of the gene nadC (Gene ID: 948869), the sequence of the gene nadD (Gene ID: 8180157) in Escherichia coli reported on NCBI ), the sequence of gene nadE (Gene ID: 8179982) designed upstream and downstream primers, and synthesized primers with BamH I and XhoI restriction sites:
[0027] pncA-F:GGATCCATGCCCCCTCGCGCCCTGTT
[0028] pncA-R: CCGCTCGAGTTACCCCTGTGTCTCTTCCCAGTCTG
[0029] pncB-F:CGCGGATCCATGACACAATTCGCTTCT
[0030] pncB-R:CCGCTCGAGTTAACTGGCTTTTTTAATATGCGG
[0031] nadC-F: GGATCCATGCCGCCTCGCCGCTATAACC
[0032] nadC-R:CTCGAGTTAGCGAAAACGCATTGAAAGGTCGAGTG
[0033] nadD-F:CGCGGATCCATGAAATCTTTACAGGCTC
[0034] nadD-R: CCGCTCGAGTCAGCGATACAAGCCTTGTT
[0035] nadE-F:CGCGGATCCATGACATTGCAACAACAAAT
[0036] nadE-R:CCGCTCGAGTTACTTTTTCCAGAAATCAT...
Embodiment 2
[0044] (1) Construction of Escherichia coli recombinant strains co-expressing multiple genes:
[0045] Design upstream and downstream primers based on the successfully constructed plasmids pET-21a-pncA, pET-21a-pncB, pET-21a-nadC, pET-21a-nadD, pET-21a-nadE, and add On the SD-AS sequence (AGAAGGAGATATACA), the overlapping extension PCR technology is used to realize the tandem expression of multiple genes on the same plasmid.
[0046] Synthesize primers with BamH I and Xho I restriction sites, using plasmids pET-21a-pncA, pET-21a-pncB, pET-21a-nadC, pET-21a-nadD, pET-21a-nadE as templates, overlapping The target genes pncA-pncB, pncA-nadD, pncA-nadE, pncB-nadD, pncB-nadE, nadD-nadE, nadC-nadD, nadC-nadE and pncA-pncB-nadD, pncA-nadD- nadE, pncB-nadD-nadE, nadC-nadD-nadE, pncA-pncB-nadE fragments, the reaction conditions are: pre-denaturation at 98°C for 30s; denaturation at 98°C for 10s; annealing at 60°C for 15s; extension at 72°C for 112s, 80s, and 90s, respectively . 10mi...
Embodiment 3
[0054] (1) Preparation of functional factor promoter: tryptophan, aspartic acid, quinolinic acid, nicotinic acid, and nicotinamide were respectively dissolved in sterilized ultrapure water to prepare a solution with a final concentration of 100 mg / L.
[0055] (2) The initial strain E.coli BL21 / pET-21a was fermented and cultured in a 50ml shake flask for aerobic fermentation. Transfer 1% of the inoculum from the cryopreservation tube into a 5mL LB test tube, and at the same time add ampicillin with a final concentration of 100μg / mL, culture for 12 hours, then transfer to 50mL of LB fermentation medium at 1% of the inoculum Add functional factor promoters with a final concentration of 40mg / L, and culture at 37°C and 200r / min until OD 600 When it is 0.6-2.0, add IPTG with a final concentration of 0.1-10mmol / L, induce at 16-37°C, 200r / min.
[0056] 3. Determination of intracellular NAD in the initial strain E.coli BL21 / pET-21a cultured by adding different precursor substances + ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


