Unlock instant, AI-driven research and patent intelligence for your innovation.

Heterodera avenae Ha-16674 protein, encoding gene and application thereof

A cereal cyst nematode, ha-16674 technology, applied in the fields of application, nematicides, genetic engineering, etc., can solve problems such as the combination of inability to resist diseases and high-yield phenotypes, environmental pollution, and defects in disease-resistant varieties

Inactive Publication Date: 2017-08-08
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the control of wheat cyst nematode disease mainly relies on chemical pesticides. On the one hand, it will cause huge pollution to the environment, and on the other hand, it may produce drug-resistant nematode populations. Therefore, wheat cyst nematode disease urgently needs green control strategies
Breeding and popularizing disease-resistant varieties of wheat is an effective measure to control wheat cyst nematode disease, but disease-resistant varieties also have certain defects, such as the inability to combine disease resistance and high-yield phenotypes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heterodera avenae Ha-16674 protein, encoding gene and application thereof
  • Heterodera avenae Ha-16674 protein, encoding gene and application thereof
  • Heterodera avenae Ha-16674 protein, encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: the acquisition of the cereal cyst nematode nematode Ha-16674 gene sequence

[0030] 1.1 Extraction of nematode total RNA

[0031]Take about 100,000 second-instar larvae, grind them thoroughly in liquid nitrogen, add 1ml Trizol reagent, and keep at room temperature for 5 minutes; add 200 μl of chloroform, mix thoroughly by inverting, and keep at room temperature for 5 minutes; centrifuge at 12000g, 4°C for 15 minutes; transfer the supernatant to a centrifuge After the tube, add 600μl isopropanol, invert and mix thoroughly, room temperature for 10min; 12000g, 4℃, centrifuge for 15min; remove the supernatant, add 1ml 75% ethanol to wash the precipitate, centrifuge at 7500g for 5min, remove the supernatant; wash with 75% ethanol The precipitation was repeated once; the precipitation was dried at room temperature; the RNA was dissolved in RNase-free water and stored in a -80°C refrigerator. Nematode RNA is reverse transcribed to synthesize cDNA first strand. ...

Embodiment 2

[0036] Embodiment 2: Cereal cyst nematode nematode Ha-16674 inhibits cell death

[0037] 2.1 Construction of Ha-16674 plant expression vector

[0038] The 5' end of the forward primer starts at ATG (start codon) and connects to the XhoI restriction site sequence, and the 3' end of the reverse primer ends at TGA (stop codon) and connects to BamHI enzyme cutting site sequence. Using the T vector containing the Ha-16674 gene sequence as a template, the target fragment was amplified with the high-fidelity enzyme Prime STAR DNA Polymerase.

[0039] Ha-16674F(xho1):CCGCTCGAG ATGCTTAGTGCTCCCCCACTG

[0040] Ha-16674R(Pst1): AAAACTGCAG CTAAAGTTCGTCGTGCTCCTCC

[0041] Amplification system: PrimeSTAR Max Premix (2×) 25μl, Ha-16674F (10mM) 2μl, Ha-16674R (10mM) 2μl, T vector 1μl, double distilled water 20μl to make up the total volume to 50μl; amplification program: 98℃, 5min; 98°C, 10s, 56°C, 10s; 72°C, 1min, 35 cycles, 72°C, 10min, 16°C storage. PCR products were detected by agaros...

Embodiment 3

[0045] Transient expression in tobacco found that single injection of Bax can cause massive cell death in tobacco leaves, and co-injection of Ha-16674 and Bax in tobacco leaves can inhibit cell death, so Ha-16674 can inhibit Bax-induced cell death in leaves. Embodiment 3: cereal cyst nematode nematode Ha-16674 developmental expression pattern

[0046] 3.1 Isolation of different instar larvae

[0047] A large number of second-instar larvae were inoculated into 7-day-old wheat (Wenmai 19) seedlings; wheat roots were collected 7 days, 20 days, and 30 days after inoculation; the infected roots were collected, washed thoroughly with water, and cut into as many pieces as possible. Small fragments; add 3 times the volume of enzyme solution, 25°C, 180rpm, shake and lyse for 16h; separate the residue with a sieve, and collect larvae of different ages; centrifuge the residue at 2000rpm for 5min, add 70% sucrose, suspend the residue, drop Add 5-10ml of water, centrifuge at 2000rpm for 5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to heterodera avenae Ha-16674 protein, an encoding gene and application thereof. An amino acid sequence of the heterodera avenae Ha-16674 protein is shown as SEQ ID NO: 1, and a cDNA full-length nucleotide sequence of a gene for encoding the heterodera avenae Ha-16674 protein is shown as SEQ ID NO: 2. Experiments show that the Ha-16674 and Bax can inhibit blade cell death caused by the Bax when being jointly injected into tobacco leaves. Full-length overexpression of the Ha-16674 gene in arabidopsis thaliana can obtain stable genetic T3 generation transgene positive plants, and calprotectin Ha-16674 in heterodera avenae can reduce immune defence reaction of the arabidopsis thaliana to promote pesudomona syringae infection. The heterodera avenae Ha-16674 protein disclosed by the invention provides a new target Ha-16674 for nematode-resistance plant culture and has good theoretical guidance significance on culturing broad-spectrum heterodera-resistance crops.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a gene sequence and coded protein of a cereal cyst nematode gene Ha-16674 and its application. Background technique [0002] Wheat cereal cyst nematode (Heterodera avenae) is an important pathogenic nematode that harms wheat, barley, oats and other gramineous crops. It has been found in 37 countries such as the United States, Canada, Australia, France, England, Norway, Italy, India, Turkey, etc. , Syria, Iran and other countries (Nicol J, I, Bolat N, et al. The global importance of the cereal cyst nematode (Heterodera spp.) on wheat and international approaches to its control [J]. Communications in agricultural and applied biological sciences, 2006, 72(3): 677-686). In Australia, the CCN damage area is as high as 2 million hectares, the general yield loss is 23-50%, and the loss is as high as 73-89% when it is severe, and the annual economic loss is 70 million US dollars (BrownR.Cul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/113A01N57/16A01P5/00
CPCC07K14/4354A01N57/16C12N15/113
Inventor 彭德良刘敬彭焕黄文坤孔令安崔江宽王高峰乔芬罗书介李新
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI