Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Exosome carrier of targeted bone, CRISPR/Cas9 gene editing system and application

A gene editing and exosome technology, applied in genetic engineering and biological fields, can solve problems such as low biocompatibility, limited application of virus vectors, and existence of danger

Active Publication Date: 2017-08-11
HOSPITAL OF STOMATOLOGY SUN YAT SEN UNIV
View PDF3 Cites 46 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Viral vectors, such as lentiviral vectors and adenoviral vectors, were first used as gene drug delivery tools, and adenoviral vectors have been successfully used in clinical trials to treat patients with Leber's congenital amaurosis. However, retroviruses can be integrated into the genome And the danger of mutating back to the wild-type virus exists, which limits the application of viral vectors
With the development of nanotechnology, artificial nanomaterials such as liposomes, nanoparticles, nanorods, nanowires, carbon nanotubes, and gold nanoparticles are increasingly used in drug delivery systems. Studies have proven that nanomaterials can effectively Delivery of drugs to the target site and play a role, but due to its synthetic characteristics, nanomaterials still have disadvantages such as low biocompatibility and poor stability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Exosome carrier of targeted bone, CRISPR/Cas9 gene editing system and application
  • Exosome carrier of targeted bone, CRISPR/Cas9 gene editing system and application
  • Exosome carrier of targeted bone, CRISPR/Cas9 gene editing system and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Example 1: Construction of exosome carriers targeting bone-forming surfaces

[0089] The exosome carrier such as figure 1 As shown, it includes sgRNA and dCas9 vectors:

[0090] 1) Construction of the lamp2b recombinant plasmid modified with targeting peptide

[0091] (1) Design primers for lamp2b, use mouse cDNA as template, obtain lamp2b fragment by PCR amplification, and purify;

[0092] Upstream primer (SEQ ID NO.7): CCTTAATTAACCATGTGCCCTCTCTCCGGTTAAAGG;

[0093] Downstream primer (SEQ ID NO. 8): CCGTTTAAACTTACTAAAATTGCTCATATCCAGTAT.

[0094] The PCR amplification reaction system is as follows:

[0095]

[0096]

[0097] The reaction conditions are as follows:

[0098]

[0099] The obtained PCR product was identified by 1% agarose gel electrophoresis, recovered and purified with a gel recovery kit, and the obtained lamp2b fragment was connected to the PMD19T vector to obtain the lamp2b-T vector.

[0100] (2) The Nsi1 restriction endonuclease cuts ...

Embodiment 2

[0108] Example 2: Construction of exosome carriers targeting bone resorption surfaces

[0109] 1) Construction of the lamp2b recombinant plasmid modified with targeting peptide

[0110] (1) Design primers for lamp2b, use mouse cDNA as template, obtain lamp2b fragment by PCR amplification, and purify;

[0111] Upstream primer (SEQ ID NO.7): CCTTAATTAACCATGTGCCCTCTCTCCGGTTAAAGG;

[0112] Downstream primer (SEQ ID NO. 8): CCGTTTAAACTTACTAAAATTGCTCATATCCAGTAT.

[0113] The PCR amplification reaction system is as follows:

[0114]

[0115] The reaction conditions are as follows:

[0116]

[0117]

[0118] The obtained PCR product was identified by 1% agarose gel electrophoresis, recovered and purified with a gel recovery kit, and the obtained lamp2b fragment was connected to the PMD19T vector to obtain the lamp2b-T vector.

[0119](2) Nsi1 restriction endonuclease cleaves the lamp2b-T vector, uses 1% agarose gel electrophoresis to identify and recovers and purifies w...

Embodiment 3

[0127] Example 3: Construction of exosome vector targeting endothelial cells

[0128] 1) Construction of the lamp2b recombinant plasmid modified with targeting peptide

[0129] (1) Design primers for lamp2b, use mouse cDNA as template, obtain lamp2b fragment by PCR amplification, and purify;

[0130] Upstream primer (SEQ ID NO.7): CCTTAATTAACCATGTGCCCTCTCTCCGGTTAAAGG;

[0131] Downstream primer (SEQ ID NO. 8): CCGTTTAAACTTACTAAAATTGCTCATATCCAGTAT.

[0132] The PCR amplification reaction system is as follows:

[0133]

[0134] The reaction conditions are as follows:

[0135]

[0136] The obtained PCR product was identified by 1% agarose gel electrophoresis, recovered and purified with a gel recovery kit, and the obtained lamp2b fragment was connected to the PMD19T vector to obtain the lamp2b-T vector.

[0137] (2) Nsi1 restriction endonuclease cuts the lamp2b-T vector, uses 1% agarose gel electrophoresis to identify and recovers and purifies with a gel recovery kit,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an exosome carrier of a targeted bone, a CRISPR / Cas9 gene editing system and application. The exosome carrier comprises a targeted peptide of any one of a targeted bone forming surface, a bone absorbing surface and an endothelial cell. The exosome carrier can be fused with (AspSerSer)6, (Asp)8 and a CREDVW oligopeptide respectively by transforming an exosome surface membrane protein lamp2b, so that an exosome can be fused with the targeted bone forming surface, the bone absorbing surface and the endothelial cell. Therefore, the bone targeting exosome is developed as the carrier, a CRISPR / Cas9 system serves as a gene editing and controlling tool, and the two parts are combined to play the important significance on the treatment of various bone diseases.

Description

technical field [0001] The invention belongs to the field of genetic engineering and biotechnology, and relates to the development of a bone-targeting gene editing system, in particular to a bone-targeting exosome carrier, CRISPR / Cas9 gene editing system and application. Background technique [0002] Bone is an important part of the human body and consists of three parts: periosteum, bone mass, and bone marrow. Normal bone tissue is always in the dynamic equilibrium process of osteoblast bone formation and osteoclast bone resorption for bone remodeling, and the two coordinate with each other to maintain the normal physiological function of bone. When this dynamic balance is disrupted, various bone diseases will occur, such as osteoporosis, osteosclerosis, bone tumors, bone metastasis of tumors, osteoarthritis, rheumatoid arthritis, etc. Due to the special structure of bone tissue, such as high hardness, poor permeability, and low blood flow, it is difficult for drugs to acc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/0783C12N15/85C12N15/90A61K47/42A61K47/46A61P19/08
CPCA61K47/42A61K47/46C12N5/0636C12N9/22C12N15/85C12N15/907C12N2800/107
Inventor 谭家莉林瑶
Owner HOSPITAL OF STOMATOLOGY SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com