Method for over-expressing cecropin in cordyceps militaris

A technology of cecropin antibacterial peptide and Cordyceps militaris, applied in the field of transgenic, can solve the problems of reduced immunity of livestock and poultry, drug residues, threats to human health, etc.

Inactive Publication Date: 2017-09-08
SHANGHAI ACAD OF AGRI SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the long-term abuse of antibiotics not only leads to decreased immunity of livestock and poultry and drug residues in animal products, but more seriously, with the toxic side effects of traditional antibiotics and the emergence of drug-resistant strains, many pathogenic bacteria are almost resistant to existing antibiotics. drug resistance, which poses a huge threat to human health

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for over-expressing cecropin in cordyceps militaris
  • Method for over-expressing cecropin in cordyceps militaris
  • Method for over-expressing cecropin in cordyceps militaris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Construction of overexpression vector:

[0041] (1) Collect the mycelium of Cordyceps militaris on the PDA, extract DNA; use primer PR1 / PR2 to amplify the promoter fragment of HSP70 gene of Cordyceps militaris, use enzyme cutting site EcroR I / SmaI, digest, digest and connect PDHt-bar , obtaining the recombinant vector PDHt-HSP;

[0042] PR1: CGGAATTCCCCCTAAATCACAAGCTTGGTCCG;

[0043] PR2: TCCCCCGGGGTTGGCGGCTTCTGTGTGTGTA.

[0044] The PCR reaction system is:

[0045] Reagent reagent Volume (μL) PCR Magic Mix 2.0 25 Primer1 2 Primer2 2 Template DNA 3 wxya 2 o

18 Total 50

[0046] PCR reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 3 min, a total of 30 cycles; finally fill-up at 72°C for 10 min, and store at 10°C.

[0047] (2) Use the upstream primer Ple for TCCCCCGGGATGGGCTTCGGCTGCAACGG; the downstream primer Ple-BamH I-revCGGG...

Embodiment 2

[0049] Transformation in Homologous Recombination Vector Cordyceps militaris

[0050] (Agrobacterium tumefaciens-mediated genetic transformation of filamentous fungi)

[0051] 1) Select a freshly cultivated Agrobacterium containing PDHt-HSP-CAD vector from the LB plate (containing 50 μg / mL kanamycin)

[0052] AGL-1 single colonies were inoculated in 5 mL LB liquid medium (containing 50 μg / mL kanamycin), cultured overnight at 220 rpm at 28°C.

[0053] 2) Collect the bacterial cells by centrifugation the next day, resuspend with an equal volume of liquid induction medium IM, and pipette an appropriate amount of the resuspension to 5 mL of liquid induction medium IM to make OD660=0.14-0.2.

[0054] 3) Shake culture at 28°C and 220rpm for 4-6h, and the concentration of the bacterial solution should be between OD660=0.5-0.8.

[0055] 4) Cultivation and collection of Cordyceps militaris spores: In ultra-clean work, transfer the fresh hyphae activated on PDA medium (25°C, 20d) to a...

Embodiment 3

[0061] Bacteriostatic effect detection of transgenic strains

[0062] 1) Mycelia culture

[0063] Collect the fresh spore suspension of wild-type bacterial strain and transgenic bacterial strain of embodiment 2 respectively, concentration is adjusted to 10 8 cells / mL, pipette 300 μL, inoculate into 100 mL of SDB medium, culture at 25°C, 150rmp shaker for 3 days;

[0064] 2) Mycelia were collected by filtration, freeze-dried, and stored at -80°C for later use;

[0065] 3) The mycelium was homogenized in PBS buffer solution, and the homogenate was broken, centrifuged at 4°C and 8000rmp for 5min, and the supernatant was collected;

[0066] 4) Protein quantification was performed by Bradford method.

[0067] Bacteriostasis test: E. coli DH5a stored at -80°C was inoculated into 5 mL of LB medium with an inoculation loop, and cultured overnight at 37°C and 250 rpm on a shaker for 10-12 hours. The Escherichia coli cultured overnight was inoculated into fresh LB medium at a ratio ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for over-expressing cecropin in cordyceps militaris. The method comprises the following steps: constructing an overexpression vector of cecropin by utilizing an HSP70 promoter of cordyceps militaris; transferring the vector into a strain of cordyceps militaris through agrobacterium tumefaciens mediated transformation, performing resistance screening, thereby obtaining a transgenic strain. Compared with a wild type strain, the strain prepared by the invention has obvious bacteriostatic action on prokaryotic Escherichia coli and staphylococcus aureus and has a potential utilization value for replacing antibiotics.

Description

technical field [0001] The invention belongs to the field of transgenic technology, in particular to a method for overexpressing cecropin antimicrobial peptide in Cordyceps militaris. Background technique [0002] Antimicrobial peptides are highly conserved and ubiquitous natural immune system factors in evolution, and have broad-spectrum antibacterial, antiviral, antitumor and other biological activities, and are not easy to form drug resistance and drug residues. Antibacterial peptides (ABPs), also known as antimicrobial peptides (AMPs) or host defense peptides (HDPs), are a class of small molecules induced by organisms with broad-spectrum antibacterial and immunomodulatory activities. Polypeptides, which are an intrinsic part of the body's non-specific defense system, are present in almost all life forms (insects, amphibians, birds, fish, mammals, plants, and humans). Antimicrobial peptides are usually composed of 12 to 50 amino acids, and the relative molecular mass is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/80C12N15/12C12N1/15
CPCC07K14/43586C12N15/80C12N2830/34
Inventor汪滢鲍大鹏唐利华高英女王莹
OwnerSHANGHAI ACAD OF AGRI SCI