Kit for detecting gastric cancer

A kit and technology for gastric cancer, applied in the detection/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of low accuracy, high cost, and inability to meet large-scale genetic screening, etc., to improve sensitivity and specificity, easy detection, and convenient and easy diagnosis

Active Publication Date: 2018-07-31
银丰基因科技有限公司
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The existing technology detects gastric cancer susceptible populations, using hybridization chip method or glass plate chip method, and using taqman probes. This method has low accuracy, high false negative and false positive rates, and cannot be detected in batches; another direct sequencing Although the accuracy rate is high, the cost is high and batch detection cannot be realized. Therefore, the existing methods cannot meet the requirements of large-scale genetic screening.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Blood Sample DNA Extraction

[0029] 1. Materials

[0030] The inventor collected a large number of blood samples from patients with new gastric cancer in Beijing 307 Hospital from January 2015 to December 2017. After sorting out the sample data, the inventor selected 30 samples that met the following criteria, and selected 10 samples at the same time. A healthy person aged 25-55 was used as a control for the whole exome microarray test. The sample selection criteria are as follows:

[0031] (1) Gastric cancer cases diagnosed by pathology, among which 4 patients have a family history of cancer and are marked as X1, X2, X3, and X4 respectively;

[0032] (2) Have not received radiotherapy or chemotherapy before blood collection, and have no previous history of cancer;

[0033] (3) The age-matched healthy controls of the cases and the systematic collection of demographic and clinical data of these samples.

[0034] 2. DNA extraction

[0035] The specific step...

Embodiment 2

[0043] Example 2 High-throughput sequencing

[0044] 1. Library construction

[0045] Shanghai Sangon Co., Ltd. uses Agilent's liquid phase chip capture system to efficiently enrich the DNA of the whole exon region of human beings, and then perform high-throughput and high-depth sequencing on the Illumina Hiseq platform. The Agilent SureSelect Human All ExonV5 kit was used for library construction and capture experiments, the reagents and consumables recommended in the instructions were strictly used, and the operation was performed according to the latest optimized experimental procedures.

[0046] The basic process of the experiment: Genomic DNA was randomly broken into fragments with a length of 150-260bp by a Covaris crusher, and after end repair and A-tailing, adapters were connected to both ends of the fragments to prepare a DNA library. After pooling the library with a specific index, perform liquid phase hybridization with biotin-labeled probes, and then use magnetic ...

Embodiment 3

[0054] Example 3 sanger sequencing

[0055] Primers were designed for position 349 of ABCG2, and the primers used were designed and synthesized by Shanghai Sangon, as shown in Table 1. The amplified size was 360bp.

[0056] Primer name

Primer sequence

Upstream primer (SEQ ID NO: 3)

atgtcttccagtaatgtcga

Downstream primer (SEQ ID NO: 4)

attacatttg atattggcag

[0057] The PCR reaction system (25 μL system) used was: Taq Buffer 2.5 μL, DNA 1 μL, forward primer 0.5 μL, reverse primer 0.5 μL, 10 mM dNTP 0.5 μL, Taq enzyme 0.2 μL, ddH 2 019.8 μL. PCR reaction program: 95°C for 3min, 35 cycles (94°C for 35s, 60°C for 35s, 72°C for 1min), 72°C for 10min. 1% agarose gel electrophoresis detection, and the PCR product gel was cut and purified with a UV gel cutter. All PCR products were sequenced with forward and reverse primer sequences, and the sequencing results were further analyzed. The above experiments were completed by Shanghai Sangong.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit for detecting a gastric cancer. The kit comprises gene mutation primers relative to the gastric cancer: a forward primer shown as SEQ ID NO. 3 and a reverse primer shownas SEQ ID NO. 4. By adopting the kit provided by the invention, a mutation site spectrum and a specific marker relative to gastric cancer incidence are acquired; development and application of the relative diagnostic kit are performed by changing a mutation site sequence, so that diagnosis of the gastric cancer can be more convenient and feasible, the foundations are laid for rapid and accurate grasping of the patient condition for a clinical doctor and clinical treatment effect evaluation, and help is provided to discover a novel micromolecular drug target with potential treatment value.

Description

technical field [0001] The invention belongs to the field of biological detection and relates to a kit for detecting gastric cancer. Background technique [0002] Gastric cancer is one of the most common malignant tumors of the digestive tract, and is a common and frequently-occurring disease that seriously threatens human health and life. According to statistics, about 900,000 people around the world are newly diagnosed with gastric cancer every year. In my country, gastric cancer ranks first among digestive tract malignancies and third among systemic malignancies. According to the data released by the Health Information Statistics Center of the Ministry of Health in 2001, malignant tumors are the first cause of death among urban residents in my country, with a mortality rate of 135.59 / 100,004.9%). Among them, gastric cancer ranks third in the cause of death from malignant tumors. The occurrence and development of gastric cancer, like other malignant tumors, is a multi-fa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/156
Inventor顾超
Owner银丰基因科技有限公司