Preparation and application of recombinant hepatitis C antigen

A technology for hepatitis C and hepatitis C virus, applied in the field of biomedicine, can solve the problems of missed diagnosis and misdiagnosis, and achieve the effect of making up for the lack of sensitivity and improving the detection sensitivity and accuracy.

Inactive Publication Date: 2018-09-14
南京京达生物技术有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is simple and easy to operate, and requires low experimental conditions, but it may cause certain missed diagnosis and misdiagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] Using the plasmid pM-HCV_Genomeo containing the full-length genomic DNA of HCV as a template, and using primers designed for each fragment of the core antigen gene, PCR amplification was performed. The amplified products were separated by electrophoresis and the corresponding specific amplified gene products were recovered by gel and subcloned. into the pMD-18 (TaKaRa, Inc) vector to obtain recombinant plasmids for each gene.

[0015] P1: GGTCTGGAACAGATTTTCTCTCACCAT

[0016] P2: CTCGGAGGTGTTGCTGTCTCCCAAGAGCGTCCTT

[0017] According to the designed restriction endonuclease sites, the corresponding gene fragments were obtained from the above-mentioned recombinant plasmids by double enzyme digestion, and the obtained gene pET41a was connected by gene subcloning technology, and the corresponding HCV core antigen expression vector was constructed to obtain the above-mentioned The expression vector of the Seq.2 coding sequence, after screening and identification, the recombi...

Embodiment 2

[0019] Example 2 Isolation and Purification of Recombinant Hepatitis C Antigen

[0020] 1. Chemical lysis of Escherichia coli BL21 expression bacteria:

[0021] The bacteria that have been induced to express are chemically lysed, and 5-10ml of bacterial lysate (2% Triton-X100, 10-50ug / ml lysozyme, 1mM DTT, 0.2M PBS, preferably Merck's) is added to each gram of wet bacteria. BugBuster solution) to fully suspend the bacteria, incubate at 37 degrees for 1 hour with slow shaking; centrifuge at 12,000 rpm at 4 degrees for 20 minutes, and collect the supernatant for the next step of affinity chromatography purification.

[0022] 2. Two-step affinity chromatography by gravity method is used to purify the target recombinant protein with a purity greater than 95%:

[0023] ] A) After the supernatant after sufficient centrifugation, the Ni2+-NTA affinity chromatography column was fully equilibrated with loading buffer (100mMNaH2PO4, 10mMTris, 10mM2-ME, pH8.0), and then the lysed supern...

Embodiment 3

[0025] Example 3 Comparison of core antigen levels in samples of different HCV genotypes

[0026] 1. Case selection

[0027] From June to September 2015, serum was collected from 203 CHC patients, including 130 males and 73 females, aged 24-76 years, with an average (37.3±8.6) years old. HCV genotypes were detected using Versant HCV Genotype 2.0 (LiPA, Siemens AG, Marburg, Germany), with genotype 1b in 41 cases, 2a in 43 cases, 3a in 31 cases, 3b in 43 cases, and 6a in 45 cases , basically covering the common genotypes in China. HCV RNA was quantified using the Roche Taqman HCV RNA Kit with a minimum detection limit of 15 IU / mL. Patients with different HCV genotypes were comparable in terms of age, gender and HCV viral load.

[0028] 2. Method

[0029] Abbott Architect HCV Ag core antigen quantitative detection kit was used to detect HCV antigen quantitatively on Abbott Architect i2000 automatic chemiluminescence instrument. The linear range of quantitative detection is 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses preparation and application of recombinant hepatitis C antigen. The amino acid sequence of the recombinant hepatitis C antigen is shown in SEQ ID No. 1, and the protein structure of the recombinant hepatitis C antigen is soluble protein. The nucleotide sequence of amino acid for encoding the recombinant hepatitis C antigen is shown in SEQ ID No. 2. A preparation method of the recombinant hepatitis C antigen comprises the steps of culturing host cells having the nucleotide sequence shown in SEQ ID No. 2, isolating and purifying for culturing to obtain polypeptide or protein molecule antigen so as to obtain the recombinant hepatitis C antigen. The recombinant hepatitis C antigen is beneficial to the normalization and standardization of hepatitis C virus (HCV) core antigen detection, can be used for preparing a kit for detecting HCV, and is beneficial to making up for the defect that the existing kit is insufficient in sensitivity when being used for detecting theHCV.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to the preparation and application of a recombinant hepatitis C antigen. Background technique [0002] Hepatitis C is one of the infectious diseases caused by hepatitis C virus (HCV) infection, which is prevalent in the world, and about 170 million people in the world are infected with HCV. After HCV infects the human body, nearly half of the people will become chronic hepatitis, which may also lead to liver fibrosis, liver cirrhosis, ascites and liver cancer, and the prognosis is poor. There are many methods for diagnosing hepatitis C virus infection at present, and the most accurate ones are hepatitis C virus recombinant immunoblotting (HCV-RIBA) and hepatitis C virus ribonucleic acid (HCV-RNA) detection, but these two methods are complicated to operate and require strict experimental conditions. , and the cost is high, and the hospital application is less. The traditional...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/18C12N15/13G01N33/569A61K39/29A61P1/16A61P31/14
CPCA61K39/12A61P1/16A61P31/14C07K14/005C12N2770/24222C12N2770/24234G01N33/56983G01N2333/186
Inventor李永刚王琪施苏洪马超
Owner南京京达生物技术有限公司