Myrciaria cauliflora myb transcription factor McMYB and plum bHLH transcription factor PsbHLH and application thereof
A technology of transcription factor and kabo fruit, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0032] In the present invention, the preparation method of the recombinant vector comprising the McMYB preferably comprises the following steps:
[0033] A. Using the PCR product obtained by the above scheme as a template, amplify with specific primers with adapters to obtain McMYB fragments with adapters;
[0034] B. the vector digested with NcoI and BstEII and the McMYB fragment with the linker to obtain a linear vector and the McMYB fragment with cohesive ends;
[0035] C. Ligate the obtained linear vector and the McMYB fragment at the cohesive end to obtain the ligation product;
[0036] D. Screening the ligation product, the obtained positive plasmid is a recombinant vector containing the McMYB.
[0037] In the present invention, the specific primers with adapters include forward primers with adapters and reverse primers with adapters. The nucleotide sequence of the forward primer with adapter is as in the sequence listing
[0038] The invention provides a recombinant ...
Embodiment 1
[0047] Cloning of McMYB Gene from Jiabao Fruit
[0048] (1) Experimental method
[0049] Using the green and black pericarp of Jiabao fruit as materials, a library was constructed for transcriptome sequencing, and a MYB transcription factor McMYB that may be involved in the regulation of anthocyanin biosynthesis in Jiabao fruit was screened out through differential expression analysis of the transcriptome. According to the CDS sequence, a specific primer pair ATGGCCACGCCGCCGAGCAG (SEQ ID No. 3) and CATGACATCTGATGTAATTAGGAGTC (SEQ ID No. 4) was designed, and PCR amplification was performed to obtain the sequence of the McMYB coding region, which was then verified by sequencing. The PCR reaction system is 50 μl, and the components are: I-5TM2xHigh-Fidelity Master Mix 25 μl, upstream and downstream primers (10 μM) each 2 μl, cDNA 1 μl, H 2 O 20 μl. The PCR program was: pre-denaturation at 90°C for 3min, 35 cycles of 98°C for 15s, 56°C for 15s and 72°C for 20s, and 72°C for 5min...
Embodiment 2
[0053] Detection of anthocyanin content in Jiabao fruit peel and analysis of McMYB gene expression pattern
[0054] (1) Experimental method
[0055] Gerber fruit development period: green stage and black stage fruit. Three biological replicates were set up for each development period of Jiabaoguo fruit, and each replicate had 10 fruits. After the peel was removed, it was frozen in liquid nitrogen and stored at -80°C until use.
[0056] Weigh 0.5g of pericarp and grind it into powder in liquid nitrogen, add 5ml of methanol containing 0.05% HCl to the sample powder, extract at 4°C for 24h, and then centrifuge at 8,000×g for 20min. Take 1 mL of supernatant and mix with 4 mL of buffer A (0.4mol / L KCl, pH 1.0) or buffer B (1.2N citric acid, pH 4.5), and measure 510 and 700nm (A510 and A700). Anthocyanin content was calculated according to the method of Romero et al. (2008). The formula is as follows: TA=A×MW×5×100×V / e, TA is the total anthocyanin content (mg / 100g), V is the sol...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com