Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Myrciaria cauliflora myb transcription factor McMYB and plum bHLH transcription factor PsbHLH and application thereof

A technology of transcription factor and kabo fruit, applied in the field of genetic engineering

Active Publication Date: 2018-09-28
POMOLOGY RES INST FUJIAN ACAD OF AGRI SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, there are few studies on the regulation of the anthocyanin biosynthesis pathway of the jabo fruit, and there is no reported transcription factor that effectively regulates the anthocyanin biosynthesis of the jabo fruit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Myrciaria cauliflora myb transcription factor McMYB and plum bHLH transcription factor PsbHLH and application thereof
  • Myrciaria cauliflora myb transcription factor McMYB and plum bHLH transcription factor PsbHLH and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0032] In the present invention, the preparation method of the recombinant vector comprising the McMYB preferably comprises the following steps:

[0033] A. Using the PCR product obtained by the above scheme as a template, amplify with specific primers with adapters to obtain McMYB fragments with adapters;

[0034] B. the vector digested with NcoI and BstEII and the McMYB fragment with the linker to obtain a linear vector and the McMYB fragment with cohesive ends;

[0035] C. Ligate the obtained linear vector and the McMYB fragment at the cohesive end to obtain the ligation product;

[0036] D. Screening the ligation product, the obtained positive plasmid is a recombinant vector containing the McMYB.

[0037] In the present invention, the specific primers with adapters include forward primers with adapters and reverse primers with adapters. The nucleotide sequence of the forward primer with adapter is as in the sequence listing

[0038] The invention provides a recombinant ...

Embodiment 1

[0047] Cloning of McMYB Gene from Jiabao Fruit

[0048] (1) Experimental method

[0049] Using the green and black pericarp of Jiabao fruit as materials, a library was constructed for transcriptome sequencing, and a MYB transcription factor McMYB that may be involved in the regulation of anthocyanin biosynthesis in Jiabao fruit was screened out through differential expression analysis of the transcriptome. According to the CDS sequence, a specific primer pair ATGGCCACGCCGCCGAGCAG (SEQ ID No. 3) and CATGACATCTGATGTAATTAGGAGTC (SEQ ID No. 4) was designed, and PCR amplification was performed to obtain the sequence of the McMYB coding region, which was then verified by sequencing. The PCR reaction system is 50 μl, and the components are: I-5TM2xHigh-Fidelity Master Mix 25 μl, upstream and downstream primers (10 μM) each 2 μl, cDNA 1 μl, H 2 O 20 μl. The PCR program was: pre-denaturation at 90°C for 3min, 35 cycles of 98°C for 15s, 56°C for 15s and 72°C for 20s, and 72°C for 5min...

Embodiment 2

[0053] Detection of anthocyanin content in Jiabao fruit peel and analysis of McMYB gene expression pattern

[0054] (1) Experimental method

[0055] Gerber fruit development period: green stage and black stage fruit. Three biological replicates were set up for each development period of Jiabaoguo fruit, and each replicate had 10 fruits. After the peel was removed, it was frozen in liquid nitrogen and stored at -80°C until use.

[0056] Weigh 0.5g of pericarp and grind it into powder in liquid nitrogen, add 5ml of methanol containing 0.05% HCl to the sample powder, extract at 4°C for 24h, and then centrifuge at 8,000×g for 20min. Take 1 mL of supernatant and mix with 4 mL of buffer A (0.4mol / L KCl, pH 1.0) or buffer B (1.2N citric acid, pH 4.5), and measure 510 and 700nm (A510 and A700). Anthocyanin content was calculated according to the method of Romero et al. (2008). The formula is as follows: TA=A×MW×5×100×V / e, TA is the total anthocyanin content (mg / 100g), V is the sol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a myrciaria cauliflora myb transcription factor McMYB, a protein and application thereof and belongs to the technical field of genetic engineering. The invention provides themyrciaria cauliflora myb transcription factor McMYB which has a nucleotide sequence of SEQ ID No.1 as shown in the specification. The myrciaria cauliflora myb transcription factor McMYB is capable ofregulating and controlling expression of a myb gene joining in biosynthesis of anthocyanin of myrciaria cauliflora, and study shows that McMYB gene expression is positively correlated with the contentof anthocyanin in peel of myrciaria cauliflora, and is capable of intensively inducing tobacco leaves to accumulate anthocyanin. Results show that McMYB provided by the invention is capable of effectively regulating and controlling biosynthesis of anthocyanin of plants. The myrciaria cauliflora myb transcription factor McMYB has a transcription regulation and control function on biosynthesis of anthocyanin, and can be applied to biosynthesis of anthocyanin of plants.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a myb transcription factor McMYB, protein and application thereof. Background technique [0002] Myrciaria cauliflora is native to Brazil, and its peel is rich in bioactive substances such as anthocyanins. Anthocyanins have a good health care effect on the human body, and have the functions of preventing diseases such as cardiovascular disease, neurological disease, cancer, diabetes and Alzheimer's disease, and enhancing visual acuity. [0003] The plant anthocyanin biosynthetic pathway is a branch of the flavonoid biosynthetic pathway, and it is a relatively well-studied secondary metabolic pathway. Anthocyanin synthesis is cooperatively regulated by transcription factors MYB, bHLH and WD40 repeat proteins. MYB, bHLH and WD40 repeat proteins form MBW complexes and bind to homeopathic elements of structural gene promoters in the anthocyanin synthesis path...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/10C07K14/415C12N15/82C12N1/21A01H5/00A01H6/82
CPCC07K14/415C12N15/1096C12N15/825C12Q2531/113
Inventor 张雅玲方智振叶新福
Owner POMOLOGY RES INST FUJIAN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com