Lactobacillus plantarum capable of producing antibacterial peptide as well as application thereof

A technology of Lactobacillus plantarum and bacteriostatic peptide, applied in the direction of Lactobacillus, application, bacteria, etc., to achieve good tolerance, broad application prospects, and good antibacterial effect

Active Publication Date: 2018-10-02
NANJING NORMAL UNIVERSITY
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are many reports on the isolation of lactic acid bacteria from dairy products, pickles, human and animal intestines, feces, soil, etc. However, there are fewer reports on the isolation of lactic acid bacteria from aquatic animals such as fish and shellfish. Animals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactobacillus plantarum capable of producing antibacterial peptide as well as application thereof
  • Lactobacillus plantarum capable of producing antibacterial peptide as well as application thereof
  • Lactobacillus plantarum capable of producing antibacterial peptide as well as application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: the separation and purification of lactic acid bacteria

[0029] Take out the perch feces, weigh 1g and place it in a test tube filled with 9mL sterile normal saline, and mix evenly with a vortex mixer; 5 Take 0.1mL of the dilution solution from the three dilutions of the sample bacterial suspension, spread them on the MRS solid plate added with bromocresol purple respectively, culture at 37°C for 48 hours, and select a light yellow colony on the medium plate Carry out four-section line, culture at 37°C for 24-48 hours, repeat the line 2-3 times, and obtain the purified strain; carry out Gram staining and catalase experiments on the purified strain, and select Gram Bacterial strains with positive staining and negative catalase test.

Embodiment 2

[0030] Embodiment 2: the screening of producing antimicrobial peptide lactic acid bacteria

[0031] (1) Preparation of fermentation supernatant

[0032] Inoculate the fully purified bacterial strain obtained in Example 1 into MRS liquid medium, and culture it statically at 37°C for 24 hours to obtain the strain fermentation broth, which was centrifuged at 4°C and 10000r / min for 10 minutes, Keep the supernatant.

[0033] (2) Screening of bacteriostatic lactic acid bacteria

[0034] For common spoilage bacteria that cause food spoilage, select Escherichia coli, Bacillus subtilis, and Staphylococcus aureus. Use the fermentation supernatant obtained in step (1) to carry out the antibacterial experiment by the hole punching method, and screen out the bacterial strains with antibacterial activity. The specific results of strain YLY-1 of the present invention in the screening process of bacteriostatic lactic acid bacteria are shown in Table 1.

[0035] Table 1 The preliminary scr...

Embodiment 3

[0048] Embodiment 3: the identification of producing bacteriostatic peptide lactic acid bacteria strain

[0049] A selected bacteriostatic-producing lactic acid bacteria strain YLY-1 was cultured to the logarithmic growth phase, and its genomic DNA was extracted. Its 16s rDNA fragment was amplified using primers (forward primer AGAGTTTGATCCTGGCTCAG; reverse primer AAGGAGGTGATCCAGCCGCA), and sent to Sangon Bioengineering (Shanghai) Co., Ltd. for sequencing. ). Through sequence alignment, it was proved to be Lactobacillus plantarum, named as Lactobacillus plantarum (Lactobacillus plantarum) YLY-1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses lactobacillus plantarum capable of producing antibacterial peptide. The strain is lactobacillus plantarum YLY-1, is preserved in China General Microbiological Culture Collection Center (CGMCC) on March 8, 2018, and the preservation number is CGMCC NO.15429. The invention also discloses the application of the lactobacillus plantarum capable of producing antibacterial peptideto the aspect of inhibiting drunk bullacta exarata putrefying bacteria. The lactobacillus plantarum YLY-1 provided by the invention has high tolerance and is stable under the acidic condition; and the generated antibacterial peptide has a good antibacterial effect on the bullacta exarata putrefying bacteria and has a wide application prospect in food preservation.

Description

technical field [0001] The invention relates to a strain of plant lactobacillus, in particular to a strain of plant lactobacillus producing bacteriostatic peptide and its application in inhibiting snail spoilage bacteria, belonging to the technical field of food microorganisms. technical background [0002] At present, a large number of food preservatives have been used in the food industry to prevent food spoilage and prolong the shelf life of food. Among them, synthetic chemical preservatives occupy a dominant position in my country's food industry due to their low cost, convenient use and good antiseptic effect. However, these synthetic preservatives will have a negative impact on the taste and flavor of food during use, and will Together with the food, it is ingested and absorbed by the body, causing certain toxic effects on the body. Natural preservatives derived from animals, plants and microorganisms have attracted the attention of many scholars because of their safet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/20C12N1/02A23L3/3571C12R1/25
CPCA23L3/3571C12N1/02C12R2001/25C12N1/205A23V2400/169
Inventor 周涛姚雪婷马颖
Owner NANJING NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap