PCR (polymerase chain reaction) amplification primer for fast detecting mannheimia haemolytica and application thereof
A technology of Mannella and amplification primers, which is applied in the field of animal bacteriology and molecular biology, can solve problems such as economic losses, difficulties in prevention and control measures, and difficulties in accurate identification, and achieve high-sensitivity effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] 1. Preparation of materials
[0044] Mannella hemolytica, Cryptobacterium crypticus, Klebsiella, Escherichia coli, Salmonella, Pasteurella, and Mycoplasma bovis were isolated, identified and preserved by Guangxi Veterinary Research Institute, and tissue samples were obtained from veterinary clinics. PCR master mix and bacterial genomic DNA extraction kit were purchased from Kangwei Century Biotechnology Co., Ltd.
[0045] 2. Design and synthesis of PCR primers
[0046] Download the M. hemolytica gcp gene sequence in GenBank, perform homology comparison analysis and screening, select the conserved sequence region as the amplification region, and design specific amplification primers. The sequences of the primers are:
[0047] Forward primer: 5ˊ- GGGCAATACGAACTACTCGG -3ˊ SEQ ID NO:1
[0048] Reverse primer: 5ˊ- TCGTATTCGCAGCAAAGGTT -3ˊ SEQ ID NO:2
[0049] The size of the amplified target gene fragment is 220 bp,
[0050] The upstream and downstream primers were diluted...
Embodiment 2
[0078] Example 2 Rapidly detects the annealing temperature test of the PCR amplification primer of Mannella hemolytica
[0079] Perform PCR amplification on annealing temperatures of 45°C, 47°C, 49°C, 51°C, 53°C, 55°C, and 57°C to determine the best annealing temperature. The results show that the designed primers have a strong tolerance to the annealing temperature, and at the above annealing temperature, a single target band can be well amplified ( figure 1 ). The annealing temperature used in the PCR method established in the present invention is 51°C.
Embodiment 3
[0080] The specificity detection of embodiment 3 Mancheolia hemolyticus PCR amplification primers
[0081] Extract the genomic DNA and water of Mannella hemolyticus, Bacillus crypticus, Klebsiella, Escherichia coli, Salmonella, Pasteurella, Mycoplasma bovis, use the optimized reaction system and reaction program to carry out PCR amplification, and detect the present invention According to the specificity of the PCR amplification primers, the results showed that only the Mannella hemolytica sample amplified the target fragment band, which was a positive result, and no amplification band was detected in the 6 control strain reaction tubes and the water control reaction tube with a negative result ( figure 2 ), showing that the PCR amplification primers of the present invention have good specificity.
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap