Unlock instant, AI-driven research and patent intelligence for your innovation.

PCR (polymerase chain reaction) amplification primer for fast detecting mannheimia haemolytica and application thereof

A technology of Mannella and amplification primers, which is applied in the field of animal bacteriology and molecular biology, can solve problems such as economic losses, difficulties in prevention and control measures, and difficulties in accurate identification, and achieve high-sensitivity effects

Inactive Publication Date: 2018-11-02
GUANGXI VETERINARY RES INST
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, Mandella hemolyticus is distributed all over the world, causing significant economic losses to the cattle and sheep industries
Clinically, Mannella haemolytica and Pasteurella multocida can not only be infected alone, but also secondary infection or mixed infection, and cause similar respiratory symptoms, which makes it difficult to take targeted prevention and control measures
[0003] The conventional method to identify Mannella hemolyticus is to isolate and identify the pathogen, that is, to identify the phenotypic characteristics and biochemical indicators of the bacteria, but this identification method has disadvantages such as time-consuming and laborious
In addition, due to the close resemblance between Mannella hemolyticus and Pasteurella multocida in terms of shape size, staining characteristics, etc., it is difficult to accurately identify the two bacteria, and it is often impossible to accurately identify the two bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR (polymerase chain reaction) amplification primer for fast detecting mannheimia haemolytica and application thereof
  • PCR (polymerase chain reaction) amplification primer for fast detecting mannheimia haemolytica and application thereof
  • PCR (polymerase chain reaction) amplification primer for fast detecting mannheimia haemolytica and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] 1. Preparation of materials

[0044] Mannella hemolytica, Cryptobacterium crypticus, Klebsiella, Escherichia coli, Salmonella, Pasteurella, and Mycoplasma bovis were isolated, identified and preserved by Guangxi Veterinary Research Institute, and tissue samples were obtained from veterinary clinics. PCR master mix and bacterial genomic DNA extraction kit were purchased from Kangwei Century Biotechnology Co., Ltd.

[0045] 2. Design and synthesis of PCR primers

[0046] Download the M. hemolytica gcp gene sequence in GenBank, perform homology comparison analysis and screening, select the conserved sequence region as the amplification region, and design specific amplification primers. The sequences of the primers are:

[0047] Forward primer: 5ˊ- GGGCAATACGAACTACTCGG -3ˊ SEQ ID NO:1

[0048] Reverse primer: 5ˊ- TCGTATTCGCAGCAAAGGTT -3ˊ SEQ ID NO:2

[0049] The size of the amplified target gene fragment is 220 bp,

[0050] The upstream and downstream primers were diluted...

Embodiment 2

[0078] Example 2 Rapidly detects the annealing temperature test of the PCR amplification primer of Mannella hemolytica

[0079] Perform PCR amplification on annealing temperatures of 45°C, 47°C, 49°C, 51°C, 53°C, 55°C, and 57°C to determine the best annealing temperature. The results show that the designed primers have a strong tolerance to the annealing temperature, and at the above annealing temperature, a single target band can be well amplified ( figure 1 ). The annealing temperature used in the PCR method established in the present invention is 51°C.

Embodiment 3

[0080] The specificity detection of embodiment 3 Mancheolia hemolyticus PCR amplification primers

[0081] Extract the genomic DNA and water of Mannella hemolyticus, Bacillus crypticus, Klebsiella, Escherichia coli, Salmonella, Pasteurella, Mycoplasma bovis, use the optimized reaction system and reaction program to carry out PCR amplification, and detect the present invention According to the specificity of the PCR amplification primers, the results showed that only the Mannella hemolytica sample amplified the target fragment band, which was a positive result, and no amplification band was detected in the 6 control strain reaction tubes and the water control reaction tube with a negative result ( figure 2 ), showing that the PCR amplification primers of the present invention have good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR (polymerase chain reaction) amplification primer for fast detecting mannheimia haemolytica and application thereof, and belongs to the technical field of animal bacteriology and molecular biology. The PCR amplification primer consists of an upstream primer with the nucleotide sequence shown as SEQ ID NO:1 and a downstream primer with the nucleotide sequence shown as SEQ ID NO:2; the primers are used for preparing a PCR amplification kit for fast detecting the mannheimia haemolytica. A PCR detecting method provided by the kit has high specificity, sensibility, highrepeatability and high reliability; the detecting result is fast and accurately obtained; meanwhile, the cost is low; the operation is simple and convenient; the defects of low separation rate, timewaste, labor waste and the like of a traditional identification method are overcome; the PCR amplification primer is suitable for being used for basement layers, and can be used as a fast, accurate, simple and convenient detecting tool for fast detection of mannheimia haemolytica laboratories and survey of large-scale epidemiology.

Description

technical field [0001] The invention relates to the technical fields of animal bacteriology and molecular biology, in particular to a rapid, simple and low-cost PCR amplification primer for detecting mandella hemolyticus and its application. Background technique [0002] Mannheimia haemolytica (Mannheimia haemolytica) belongs to Pasteurellaceae and is a Gram-negative coccus bacillus. . Under the action of certain predisposing factors, Mandella hemolyticus can cause fatal pneumonia in the above-mentioned animals. Virus and mycoplasma infection make the body more susceptible to hemolytic Mannella, such as parainfluenza virus and Mycoplasma ovis pneumoniae. In addition, physical stress from environmental changes, transportation, etc., as well as reduced overall health of the animal can cause these two bacteria to cause respiratory disease or affect the severity of the disease. At present, Mandella hemolyticus is distributed all over the world, causing significant economic lo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/04C12N15/11C12R1/01
CPCC12Q1/689
Inventor 李军吴翠兰彭昊潘艳冯世文陶立李常挺胡帅马春霞谢永平钟舒红贺会利
Owner GUANGXI VETERINARY RES INST