Method for efficiently producing phenylpyruvic acid

An amino acid and deaminase technology, applied in the field of bioengineering, can solve the problems of complex separation and purification process, low enzyme activity of metabolic pathway, low PAA yield, etc., and achieves the effect of simple purification, reduced production cost, and satisfied industrialization needs.

Active Publication Date: 2018-11-20
JIANGNAN UNIV +1
View PDF20 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the long path of PPA in the bacteria, the low enzyme activity of the metabolic pathway, the low yield of PAA in the direct fermentation method, and the fermentation broth contains a large amount of impurities such as bacteria, protein, and inorganic salts, the downstream separation and purification process of PPA is complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently producing phenylpyruvic acid
  • Method for efficiently producing phenylpyruvic acid
  • Method for efficiently producing phenylpyruvic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Acquisition of Proteus mirabilis amino acid deaminase gene

[0035] (1) Proteus mirabilis was inoculated in LB medium, cultured at 30°C for 16 hours to collect the bacteria, and the genomic DNA was extracted using a bacterial genome extraction kit.

[0036] (2) Use primers PM-1 (5'CGCGGATCCATGAACATTTCAAGGAGAAAGCTAC 3', sequence shown in SEQ ID NO:5) and PM-2 (5'CCGCTCGAGTTACTTCTTAAAACGATCCAAACTAA 3', sequence shown in SEQ ID NO:6) to clone from genomic DNA Obtaining the gene of amino acid deaminase;

[0037] (3) connecting the gene to a cloning vector for sequencing to obtain a gene sequence such as SEQ ID NO: 1, and a corresponding amino acid sequence such as SEQ ID NO: 3;

[0038] (4) Digest the target gene and expression vector pET20b at 37°C for 4 hours with restriction endonucleases BamH I and XhoI;

[0039] (5) Use T4 ligase to ligate the target gene and plasmid pET20b after digestion and gel recovery at 16°C overnight;

[0040] (6) Introduce the const...

Embodiment 2

[0041] Example 2: Protein Engineering Transformation of Proteus mirabilis Amino Acid Deaminase

[0042] (1) In order to improve the catalytic performance of amino acid deaminase, the idea of ​​conformational dynamics is applied, starting from the loop structure around the product, and adjusting the amino acids on the loop that have little influence on the structure, thereby increasing the conformational dynamics of the product binding site , promote product release, weaken product inhibition, and achieve the purpose of increasing production. A total of 18 amino acid sites (Y103 / T105 / S106 / D144 / E145 / R315 / I316 / F317 / E340 / L341 / V411 / S412 / T414 / F415 / E417 / T434 / T436 / V437) was mutated, mutated to alanine in turn, and a single mutant library was constructed by using the whole plasmid PCR method, and transformed into the host E.coli BL21(DE3), and the transformation experiment was carried out at the shake flask level, and the buffer system used 0.02mol of pH 7.5 / L Tris-HCl solution, add...

Embodiment 3

[0044] Example 3: Evaluation of amino acid deaminase mutants

[0045] (1) Seed medium formula: LB medium, yeast powder 5g / L, tryptone 10g / L, NaCl 10g / L.

[0046] Fermentation medium formula: glycerol 6g / L, yeast powder 15g / L, soybean peptone 15g / L, K 2 HPO 4 12H 2 O2.56g / L, KH 2 PO 4 10.0g / L.

[0047] The composition of feed medium is: glycerol 500g / L, yeast powder 15g / L, MgSO 4 ·7H 2 O 10g / L.

[0048] (2) E.coli BL21-PM and E.coli BL21-PM5 were inoculated in the fermentation medium according to 10% inoculum amount, the air volume was 1.0-2.0vvm, the temperature was 37°C, and the stirring rate was 600rpm and cultured to OD 600 At 8.0, lower the temperature to 25°C, add 10g / L lactose to induce the expression of amino acid deaminase, when OD 600 When it reaches 12.0-14.0, the dissolved oxygen suddenly rises, and feed feeding starts at this time, and the dissolved oxygen is related to the feeding, and the dissolved oxygen is controlled at 30-50%, and the fermentation is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for high-yield production of phenylpyruvic acid, and belongs to the technical field of bioengineering. According to the method provided by the invention, amino acid deaminase from proteus mirabilis is modified by a conformational dynamics engineering method, and the gene of the modified amino acid deaminase is connected to a pET 20b carrier and expressed in E. coliBL21 (DE3). A recombinant strain is cultured in a fermentation tank, and wet thallus converted alanine is collected to produce phenylpyruvic acid; and when the amount of wet thalli is 30g / L, the yield of phenylpyruvic acid can reach 72.5 g / L and the mol conversion rate of phenylalanine can reach 96.7% after 12h of conversion.

Description

technical field [0001] The invention relates to a method for high-yielding phenylpyruvate, which belongs to the technical field of bioengineering. Background technique [0002] Phenylpyruvate (PPA) is a dihydroxy compound with the molecular formula C 9 h 8 o 3 , the structural formula is as figure 1 . PPA is often used in the fields of medicine, light industry and chemical industry, and can be used to make compound α-keto acid tablets; PPA is the raw material for the synthesis of D-phenylalanine, and D-phenylalanine is the synthesis intermediate of chiral drugs and food additives body; PPA can also be used to prepare phenyllactic acid, which can be used for antibacterial, antiseptic and flavor additives. [0003] As a multifunctional organic acid, PPA is currently mainly produced by chemical synthesis, usually through hydrolysis of α-acetamide aminocinnamic acid, synthesis of hydantoin and benzaldehyde, and dihydroxylation of benzyl chloride. A method for preparing phe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N9/80C12N1/21C12N15/70C12P7/40
CPCC12N9/80C12N15/70C12P7/40
Inventor刘佳吴静杨彬陈修来罗秋玲
OwnerJIANGNAN UNIV