Specific primer pair, probe and test kit for testing infectious splenorenal necrosis virus
A technology of spleen and kidney necrosis virus and detection kit, applied in detection kits, specific primer pairs and probes for detecting infectious spleen and kidney necrosis virus, can solve limitations, few applications of aquatic pathogen detection, false positive results, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] 1. Obtaining the positive plasmid of infectious spleen and kidney necrosis virus: through the NCBI search literature, the gene sequence of the common infectious spleen and kidney necrosis virus is listed, and the vector NTI software is used to compare and find out its conserved region, and select the DNA polymerase gene part The region was used as the target amplification segment, and it was constructed into the vector puc57 to prepare a positive plasmid for infectious spleen and kidney necrosis virus. The plasmid was synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. The partial sequence of the DNApolymerase gene selected is as follows:
[0062]GCCTGTATGGCGCAAAGGGGGTGGGCACATACTTTGCCGCACGCGTGCCCAACTACAATGCCATGCGCGATGTACAGGAGACACAGGGTGCATTTAAGATACATGAGTCGCGTGTTAGCAAGACGATGGAGTTCACAGCACGCGCCGGCCTGCCGACCGTTGGCTGGATACAGGTGTCGCAGCGATGTGTGGTGACGCGCACTGTAACAATGGCAGCCAAAGAGTACATGGTGCCTAACTGGCGTACCGATGTCAGGCCGGCCCCGGACATGGAGGGCGTGCCGCCGGCAAAGATTGTTTACTTTGACATTGAGGTCAAGTCCGA...
Embodiment 2
[0089] Select the plasmid containing the DNA polymerase gene sequence of the conserved region of infectious spleen and kidney necrosis virus synthesized by Example 1 as the detection target,
[0090] The upstream primer sequence is: 5'-TGACGCGCACTGTAACAATGGCAGCCAAAGAG-3' (SEQ ID NO: 3);
[0091] The downstream primer sequence is: 5'-CCTATCTGAAATATCACCTCGTCGTCCCTGTC-3' (SEQ ID NO:4);
[0092] The probe sequence is: 5'-ACATTGAGGTCAAGTCCGACCATGAAAACG(FAM-dT)(THF)(BHQ1-dT)TCCCCAGTGACAGG(C3-SPACER)-3'. (SEQ ID NO: 10)
[0093] Perform recombinase polymerase amplification (combined with exonuclease III) method version amplification test, and construct a 25 μl amplification reaction system as follows:
[0094] 30mM tris-acetic acid buffer pH8.0
[0095] 100mM potassium acetate
[0096] 14mM magnesium acetate
[0097] 3mM dithiothreitol
[0098] 5% polyethylene glycol (20000)
[0099] 3mM ATP
[0100] 30mM creatine phosphate
[0101] 100ng / μl creatine kinase
[0102] 600ng / μ...
Embodiment 3
[0115] Selecting a plasmid containing the gene sequence of the conserved region of infectious spleen and kidney necrosis virus as the detection target through synthesis,
[0116] The upstream primer sequence is: 5'-GATACATGAGTCGCGTGTTAGCAAGACGATGG-3' (SEQ ID NO:5);
[0117] The downstream primer sequence is: 5'-TACACAGCACCAGGCCTATCTGAAATATCACC-3' (SEQ ID NO: 6);
[0118] The probe sequence is: 5'-ACATTGAGGTCAAGTCCGACCATGAAAACG(FAM-dT)(THF)(BHQ1-dT)TCCCCAGTGACAGG(C3-SPACER)-3'. (SEQ ID NO: 10)
[0119] Utilize recombinase polymerase amplification (combined with exonuclease III) method to amplify the reaction system to amplify, and construct a 25 μl amplification reaction system as follows:
[0120] 50mM tris-acetic acid buffer pH8.0
[0121] 100mM potassium acetate
[0122] 14mM magnesium acetate
[0123] 3mM Dithiothreitol
[0124] 5% polyethylene glycol (molecular weight 20000)
[0125] 3mM ATP
[0126] 30mM creatine phosphate
[0127] 100ng / μl creatine kinase
[01...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com