Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific primer pair, probe and test kit for testing infectious splenorenal necrosis virus

A technology of spleen and kidney necrosis virus and detection kit, applied in detection kits, specific primer pairs and probes for detecting infectious spleen and kidney necrosis virus, can solve limitations, few applications of aquatic pathogen detection, false positive results, etc. question

Inactive Publication Date: 2018-12-21
江苏省渔业技术推广中心 +1
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although LAMP increases the amplification efficiency, non-specific pairing between primers easily leads to false positive results, which limits the use of LAMP methods, so it is currently less used in the detection of aquatic pathogens
Enzyme-linked immunosorbent assay (ELISA), although the test results can be quantified, easy to judge and time-consuming, but this method has high requirements for enzyme activity and is very dependent on the development of enzyme activity. Any influence on enzyme activity may affect the results. accuracy; in addition, the kits required for this type of method are expensive, which is not conducive to large-scale promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer pair, probe and test kit for testing infectious splenorenal necrosis virus
  • Specific primer pair, probe and test kit for testing infectious splenorenal necrosis virus
  • Specific primer pair, probe and test kit for testing infectious splenorenal necrosis virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] 1. Obtaining the positive plasmid of infectious spleen and kidney necrosis virus: through the NCBI search literature, the gene sequence of the common infectious spleen and kidney necrosis virus is listed, and the vector NTI software is used to compare and find out its conserved region, and select the DNA polymerase gene part The region was used as the target amplification segment, and it was constructed into the vector puc57 to prepare a positive plasmid for infectious spleen and kidney necrosis virus. The plasmid was synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. The partial sequence of the DNApolymerase gene selected is as follows:

[0062]GCCTGTATGGCGCAAAGGGGGTGGGCACATACTTTGCCGCACGCGTGCCCAACTACAATGCCATGCGCGATGTACAGGAGACACAGGGTGCATTTAAGATACATGAGTCGCGTGTTAGCAAGACGATGGAGTTCACAGCACGCGCCGGCCTGCCGACCGTTGGCTGGATACAGGTGTCGCAGCGATGTGTGGTGACGCGCACTGTAACAATGGCAGCCAAAGAGTACATGGTGCCTAACTGGCGTACCGATGTCAGGCCGGCCCCGGACATGGAGGGCGTGCCGCCGGCAAAGATTGTTTACTTTGACATTGAGGTCAAGTCCGA...

Embodiment 2

[0089] Select the plasmid containing the DNA polymerase gene sequence of the conserved region of infectious spleen and kidney necrosis virus synthesized by Example 1 as the detection target,

[0090] The upstream primer sequence is: 5'-TGACGCGCACTGTAACAATGGCAGCCAAAGAG-3' (SEQ ID NO: 3);

[0091] The downstream primer sequence is: 5'-CCTATCTGAAATATCACCTCGTCGTCCCTGTC-3' (SEQ ID NO:4);

[0092] The probe sequence is: 5'-ACATTGAGGTCAAGTCCGACCATGAAAACG(FAM-dT)(THF)(BHQ1-dT)TCCCCAGTGACAGG(C3-SPACER)-3'. (SEQ ID NO: 10)

[0093] Perform recombinase polymerase amplification (combined with exonuclease III) method version amplification test, and construct a 25 μl amplification reaction system as follows:

[0094] 30mM tris-acetic acid buffer pH8.0

[0095] 100mM potassium acetate

[0096] 14mM magnesium acetate

[0097] 3mM dithiothreitol

[0098] 5% polyethylene glycol (20000)

[0099] 3mM ATP

[0100] 30mM creatine phosphate

[0101] 100ng / μl creatine kinase

[0102] 600ng / μ...

Embodiment 3

[0115] Selecting a plasmid containing the gene sequence of the conserved region of infectious spleen and kidney necrosis virus as the detection target through synthesis,

[0116] The upstream primer sequence is: 5'-GATACATGAGTCGCGTGTTAGCAAGACGATGG-3' (SEQ ID NO:5);

[0117] The downstream primer sequence is: 5'-TACACAGCACCAGGCCTATCTGAAATATCACC-3' (SEQ ID NO: 6);

[0118] The probe sequence is: 5'-ACATTGAGGTCAAGTCCGACCATGAAAACG(FAM-dT)(THF)(BHQ1-dT)TCCCCAGTGACAGG(C3-SPACER)-3'. (SEQ ID NO: 10)

[0119] Utilize recombinase polymerase amplification (combined with exonuclease III) method to amplify the reaction system to amplify, and construct a 25 μl amplification reaction system as follows:

[0120] 50mM tris-acetic acid buffer pH8.0

[0121] 100mM potassium acetate

[0122] 14mM magnesium acetate

[0123] 3mM Dithiothreitol

[0124] 5% polyethylene glycol (molecular weight 20000)

[0125] 3mM ATP

[0126] 30mM creatine phosphate

[0127] 100ng / μl creatine kinase

[01...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a specific primer pair for testing an infectious splenorenal necrosis virus. The invention also discloses a probe used in combination with the primer pair. The invention also discloses a test kit. The invention takes the DNApolymerase gene in an infectious splenorenal necrosis virus as a test target, uses the isothermal amplification technique, and adopts a combination of aspecific primer and a probe, which improves the test convenience and specificity of the infectious splenorenal necrosis virus, and also greatly shortens the test time. Compared with the PCR test method, the method disclosed by the invention saves the product electrophoresis verification process, and avoids the false positive result, which improves the test accuracy. Compared with qPCR, the methoddisclosed by the invention is simple and easy to operate, and does not need to operate complicated instruments and equipment, which saves costs, improves the test efficiency, and is convenient to popularize and use in a wide range. Compared with other isothermal amplification methods, the test method disclosed by the invention requires less time and has a higher test accuracy.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a pair of specific primers, a probe and a detection kit for detecting infectious spleen and kidney necrosis virus. Background technique [0002] Iridovirus (iridovirus) is a kind of pathogen that is pathogenic to fish, amphibians and reptile aquatic animals. The diseases caused by its infection have caused huge economic losses to the world's aquaculture industry. The family Iridoviridae can be roughly divided into five genera, namely Iridovirus, Chloriridovirus, Ranavirus, Lymphocystivirus and Cytometavirus Genus (Megalocytivirus). Infectious spleen and kidney necrosis virus (ISKNV) is classified into the Iridoviridae cytomegalovirus genus by the International Committee On Taxnonmy of Viruses (ICTV). A linear double-stranded DNA virus with a diameter of about 140nm. Sick fish have symptoms such as spleen and kidney enlargement and anemia, which can lead to death in severe cases. It ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844
CPCC12Q1/701C12Q1/6844C12Q2521/507C12Q2522/101
Inventor 刘训猛高山珊吴亚锋贡成良于继彬
Owner 江苏省渔业技术推广中心