Acinetobacter Y-3L-asparaginase gene as well as expression and application thereof

A technology of asparaginase and Y-3, applied in application, genetic engineering, plant gene improvement, etc., can solve the problems of cumbersome separation and purification methods, low yield, complicated extraction process, etc., and achieve the inhibition of acrylamide formation, high efficiency The effect of expression

Active Publication Date: 2019-02-15
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The extraction process of L-asparaginase from animal and plant sources is complex and the yield is low, so the L-asparaginase from microorganisms that are easy to cultivate and purify has a great advantage, but the yield of wild strain L-asparaginase is low. Separation and purification methods are cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acinetobacter Y-3L-asparaginase gene as well as expression and application thereof
  • Acinetobacter Y-3L-asparaginase gene as well as expression and application thereof
  • Acinetobacter Y-3L-asparaginase gene as well as expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Acinetobacter ( Acinetobacter soli ) Cloning of Y-3 L-asparaginase gene

[0036] (1) Acinetobacter ( Acinetobacter soli ) Y-3 whole genome extraction: Acinetobacter Y-3 cells were collected by centrifugation, and the whole genome of the bacteria was extracted using the Bacterial DNA kit kit from OMGA Company.

[0037] (2) L-asparaginase primer design: according to the NCBI database Acinetobacter soli AsAase gene sequence in the whole genome nucleic acid sequence, design PCR upstream and downstream primers F1, R1, F2, R2 of L-asparaginase gene:

[0038] F1: 5'C GAGCTC ATGAATAAAATTGCCTTAATTT 3'( Sac I)

[0039] R1: 5'CCG CTCGAG TTAATCCTCAGCCTTAATGGTGG 3'( xho I)

[0040] F2: 5'TGCAAAAGCCGCAGC AGATCT ATGAATAAAATTGCCTT 3'( Bgl II)

[0041] R2: 5’GAATTCGAGCTCCCG GGTACC TTAATCCTCAGCCTTA 3'( Kpn I)

[0042] (3) Cloning of L-asparaginase gene: Use the whole genome of Acinetobacter Y-3 as a template, and use the primers designed above for PCR amplification....

Embodiment 2

[0044] Example 2: Expression and purification of recombinant L-asparaginase in Escherichia coli

[0045] (1) Expression vector construction: use pMD19-T-AsAase and vector pET30a(+) with Sac and xho Double enzyme digestion at 37°C for 9 hours. Use the gel extraction kit to recover the target fragment, T 4 Enzyme ligated overnight at 16°C, transformed into competent cells E. coliDH5α was spread on a kanamycin (Kana) resistant plate, and the positive transformants were picked for enrichment, and the extracted plasmid was named pET30a(+)-AsAase. Transform the plasmid pET30a(+)-AsAase into competent cells E. coli BL21(DE3), spread on Kana resistance plate, pick positive transformants for sequencing.

[0046] (2) Expression of recombinant L-asparaginase: the recombinant bacteria were inoculated in LB liquid medium containing 100 μg / mL Kana, and cultured overnight at 37°C and 180 rpm to make seed liquid. Then transfer 1% of the inoculum to the corresponding 100ml LB ...

Embodiment 3

[0050] Embodiment 3: Expression and purification of recombinant L-asparaginase in Bacillus subtilis

[0051] (1) Expression vector construction: use pMD19-T-AsAase and vector PCBS345 with Bgl II and Kpn Double enzyme digestion at 37°C for 9 hours. Use the gel extraction kit to recover the target fragment, T 4 Enzyme ligated overnight at 16°C, transformed into competent cells E. coli DH5α was spread on the resistance plate, and the positive transformants were picked to multiply, and the extracted plasmid was named PCBS345-AsAase. Transformation of plasmid PCBS345-AsAase into competent cells B. subtilis 001, pick positive transformants for sequencing.

[0052] (2) Expression of recombinant L-asparaginase: the recombinant bacteria were inoculated in the fermentation medium and cultured at 37°C and 180 rpm for 24-48h.

[0053] (3) Purification of recombinant L-asparaginase: the cells were collected by centrifugation at low temperature, and the supernatant was the crud...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an acinetobacter Y-3L-asparaginase gene as well as expression and application thereof. The L-asparaginase gene disclosed by the invention is derived from a strain of acinetobacter soli Y-3 (preservation number of the strain: CGMCC NO:14831) screened from soil, and a nucleotide sequence is as shown in SEQ. ID NO.1. The L-asparaginase has good catalytic activity, effectivelyinhibits the formation of acrylamide in fried foods, can fundamentally control the production of potential carcinogenic substance acrylamide in the high-temperature processing of starch-containing foods, and has a broad application prospect in the field of food processing.

Description

technical field [0001] The invention relates to an Acinetobacter Y-3 L-asparaginase gene and its expression and application, belonging to the field of biotechnology. Background technique [0002] L-asparaginase (EC3.5.1.1) belongs to threonine aminohydrolase, which can specifically catalyze the formation of L-aspartic acid and ammonia from L-asparagine. L-asparaginase can hydrolyze asparagine to prevent the Maillard reaction of asparagine and reducing sugar to form acrylamide, and control the formation of acrylamide in high-heat processed foods from the root, while affecting the production process, product appearance, flavor and Nothing has changed in terms of nutrition etc. [0003] Using L-asparaginase to remove asparagine from raw materials is currently the most effective method for controlling acrylamide content in high-heat processed foods. By adding asparaginase before baking or frying food, L-asparagine in food raw materials is hydrolyzed into L-aspartic acid and am...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20C12N15/55C12N9/50C12N15/70C12N15/75A23L29/00C12R1/01
CPCA23L5/25A23L29/06C12N9/82C12N15/70C12N15/75C12Y305/01001C12R2001/01C12N1/205
Inventor吕凤霞焦琳舒陆兆新张充别小妹赵海珍
OwnerNANJING AGRICULTURAL UNIVERSITY