Unlock instant, AI-driven research and patent intelligence for your innovation.

A Strain of Bacillus siamese and Its Application

A bacillus and fungus technology, applied in applications, bacteria, fungicides, etc., can solve problems such as harming humans and animals, harming non-target organisms, and generating drug resistance

Active Publication Date: 2021-07-30
HEBEI AGRICULTURAL UNIV.
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the extensive use of chemical pesticides, it has brought many negative effects, such as polluting the ecological environment, endangering humans and animals, producing drug resistance, harming non-target organisms, and pesticide residues, which have seriously affected a series of problems such as human health and ecological balance. Prompting people to explore new plant pest control strategies that are harmless to humans and the environment and have good control effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Strain of Bacillus siamese and Its Application
  • A Strain of Bacillus siamese and Its Application
  • A Strain of Bacillus siamese and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1 Microorganism is isolated from soil

[0024] From the rhizosphere soil with serious incidence of corn stalk rot in Dongling, Shenyang, weigh 10g of soil and mix it with 90mL sterile water, then take 1mL sample from it and dilute it with 9mL sterile water for 6 times. into 10 -6 、10 -7 、10 -8 3 gradients, pipette 100 microliters of the bacterial suspension of the three gradients, spread on LB solid medium (medium composition: tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L , agar, 15g / L) plate, the next dilution was used as a control, cultured at 28°C, and observed every 24h. Select the strain that has no colonies in the control but grows colonies in the previous dilution, and select a single colony according to the characteristics of the colony shape, color, etc., culture it in liquid LB medium, and number it after purification.

Embodiment 2

[0025] Example 2 Screening of antagonistic strains

[0026] Screening of antagonistic bacteria for the prevention and treatment of plant fungal diseases: evenly add 100 μL to a sterilized petri dish with a concentration of 1X10 7 cfu / mL Fusarium graminearum suspension, pour into 20 mL of molten LB medium cooled to about 50 °C and mix well. After the culture medium is completely solidified, use an inoculation loop to inoculate the antagonistic bacteria to be tested, spot 8-10 bacterial strains to be tested in each plate, and culture them in an incubator at 28°C for 48 hours to detect the presence and size of the inhibition zone. After the initial test, the strains with antagonistic effect were purified and repeated tests were carried out. The basic method was the same as above, and 4 strains were spotted on each plate, and each plate was repeated 3 times. The degree of antagonism was determined according to the width of the antagonism zone (distance between the edge of the in...

Embodiment 3

[0027] Example 3 Sequence Determination and Analysis of 16S rDNA of Bacterial Strains and Identification of Physiological and Biochemical Tests

[0028] The DNA of Bacillus siamese was extracted using the CTAB method, and the 16S rDNA sequence was amplified with bacterial universal primers. The primer sequences were 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction system (50 μL) was: 5 μL of 10X PCR buffer, 4 μL of dNTP, 1 μL of each primer, 2.5 μL of DNA template, 0.25 μL of Takara Taq enzyme, and 36 μL of ultrapure water. The PCR amplification program was 3 min at 94 °C; 1 min at 94 °C, 1 min at 52 °C, 1.5 min at 72 °C, 30 cycles; 10 min at 72 °C. The amplified products were sent to Beijing Huada Gene Biotechnology Co., Ltd. for sequencing. The measured 16S rDNA sequence was input into NCBI, and BLAST software was used for homology search. The 16S rDNA sequences of different strains were selected and compared with the known 16S rDNA in NCBI for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kind of bacillus siamese ( Bacillus siamensis ) GL‑02, its deposit number is CGMCC No.16068. The single colony formed by the strain on beef extract peptone (NB) medium is round, milky white, slightly raised in the center, moist and transparent on the surface; microscopically, it is rod-shaped, with flagella, and the size is 0.7~0.8*1.6~ 2.2 μ M, G+, with spores; all can grow on the beef extract protein age medium containing 2%-5%NaCl; the formula of the beef extract protein age (NB) medium is beef extract 3g, protein age 10g , agar 12g, water 1L, pH6.8‑7.0. Bacillus siamese ( Bacillus siamensis ) GL‑02 has significant antagonistic effect on the pathogenic bacteria causing corn stalk rot, small leaf spot and Curvularia leaf spot. The present invention also provides Bacillus siamese ( Bacillus siamensis ) The application of GL‑02 in the prevention and treatment of plant fungal diseases, or the application in the preparation of microbial preparations for the control of plant fungal diseases.

Description

technical field [0001] The invention relates to a bacillus siamese and its application for preventing and treating corn fungal diseases, and belongs to the field of microorganisms applied to agricultural plant protection. Background technique [0002] Plant diseases are one of the main factors affecting agricultural production, and chemical pesticides have always played a very important role in the prevention and control of plant diseases and insect pests. However, due to the extensive use of chemical pesticides, it has brought many negative effects, such as polluting the ecological environment, endangering humans and animals, producing drug resistance, harming non-target organisms, and pesticide residues, which have seriously affected a series of problems such as human health and ecological balance. It prompts people to explore new plant pest control strategies that are harmless to humans and the environment and have good control effects. With the rise of research and deve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/22A01P3/00C12R1/07
CPCA01N63/00C12N1/20C12N1/205C12R2001/07
Inventor 郭浩邢继红董金皋柳健虎张康曹宏哲
Owner HEBEI AGRICULTURAL UNIV.