A hydroxylase mutant
A hydroxylase and mutant technology, applied in the field of biocatalysis, can solve the problems of low catalytic efficiency and achieve the effect of improving catalytic activity and mild enzyme catalytic reaction conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] The construction of embodiment 1 wild-type DMDH and CPR2 gene co-expression plasmid
[0062] 1. The DMDH gene SEQ ID NO:2 (or PgPPDS) and the CPR2 gene SEQ ID NO:6 (or AtCPR2) used were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and the target gene was loaded on the pUC57 vector to obtain pUC57 respectively -DMDH and pUC57-CPR2 plasmids, templates for subsequent PCR amplification.
[0063] 2. The construction of wild-type DMDH and CPR2 gene co-expression plasmid comprises the following steps:
[0064] 2.1 Using Invitrogen's vector pYES2.1 / V5-his-TOPO as a template, use the following primer pair (5'-3') to amplify the vector fragment.
[0065] pYES2.1-vector-F:AAGCTGCGGCCCTGCATTAA,
[0066] pYES2.1-vector-R:ACGCGCCCTGTAGCGCCCCA.
[0067] 2.2 Use the following primer pair (5'-3') to amplify the promoter TDH3p using the Saccharomyces cerevisiae BY4742 genomic DNA as a template.
[0068] TDH3p-F: ctgttccagagaacccccatggtttaaacaccctggtcgacCAGTTCGAGTTTATCATTATC...
Embodiment 2
[0088] Embodiment 2 error-prone PCR method constructs hydroxylase random mutant library
[0089] Using the plasmid pYES2.1-DMDH-CPR2 obtained in Example 1 as a template, an error-prone PCR technique was used to construct a random mutant library, and the primer pairs used were as follows:
[0090] Forward primer Errorpcr-F: ATGGTTTTGTTCTTTTTCTTT,
[0091] Reverse primer Errorpcr-R: AATTATGTGGATGTAAATGT.
[0092] 50μL error-prone PCR reaction system includes: 50ng plasmid template pYES2.1-DMDH-CPR2, 30pmol pair of primers Errorpcr-F and Errorpcr-R, 1X Taq buffer, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, 1mMdTTP, 7mM MgCl 2 , (0mM, 0.05mM, 0.1mM, 0.15mM, 0.2mM) MnCl 2 , 2.5 units of Taq enzyme (Fermentas). The PCR reaction conditions were: 95°C for 5min; 94°C for 30s, 55°C for 30s, 72°C for 2min / kbp; 30 cycles; 72°C for 10min. The 1.5kb random mutation fragment was recovered from the gel as a large primer, and MegaPrimer PCR was performed with KOD-plus DNA polymerase: 94°C for 5min;...
Embodiment 3
[0093] Expression and preparation of embodiment 3 hydroxylase
[0094] The expression host was Saccharomyces cerevisiae BY4742MATa his3Δ1leu2Δ0met15Δ0ura3Δ0 strain. References for transformation, expression and preparation of enzyme solutions (Han, J.-Y., H.-S.Hwang, S.-W.Choi, H.-J.Kim and Y.E.Choi. Cytochrome P450 CYP716A53v2Catalyzes the Formation ofProtopanaxatriol from Protopanaxadiol During Ginsenoside Biosynthesis inPanax Ginseng.Plant Cell Physiol.2012,53(9):1535–1545.), the specific method is as follows:
[0095] The host strain BY4742 was streaked on the YPD solid medium, cultured at 30°C for 2 days, and a single colony was picked and transferred to a test tube containing 4ml of YPD liquid medium. Cultivate overnight at 30°C and 220rpm, transfer to a 250ml shake flask filled with 25ml YPD liquid medium, cultivate at 30°C and 220rpm for 4-6 hours, and cultivate to OD 600 0.8-1.0, the bacterial solution is used to prepare the transformation competence of Saccharomyce...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



