A hydroxylase mutant

A hydroxylase and mutant technology, applied in the field of biocatalysis, can solve the problems of low catalytic efficiency and achieve the effect of improving catalytic activity and mild enzyme catalytic reaction conditions

Active Publication Date: 2020-10-16
ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the catalytic efficiency of the DMD hydroxylase is low. If it is modified to greatly increase the enzyme activity, it will provide feasibility for industrial applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A hydroxylase mutant
  • A hydroxylase mutant
  • A hydroxylase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] The construction of embodiment 1 wild-type DMDH and CPR2 gene co-expression plasmid

[0062] 1. The DMDH gene SEQ ID NO:2 (or PgPPDS) and the CPR2 gene SEQ ID NO:6 (or AtCPR2) used were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and the target gene was loaded on the pUC57 vector to obtain pUC57 respectively -DMDH and pUC57-CPR2 plasmids, templates for subsequent PCR amplification.

[0063] 2. The construction of wild-type DMDH and CPR2 gene co-expression plasmid comprises the following steps:

[0064] 2.1 Using Invitrogen's vector pYES2.1 / V5-his-TOPO as a template, use the following primer pair (5'-3') to amplify the vector fragment.

[0065] pYES2.1-vector-F:AAGCTGCGGCCCTGCATTAA,

[0066] pYES2.1-vector-R:ACGCGCCCTGTAGCGCCCCA.

[0067] 2.2 Use the following primer pair (5'-3') to amplify the promoter TDH3p using the Saccharomyces cerevisiae BY4742 genomic DNA as a template.

[0068] TDH3p-F: ctgttccagagaacccccatggtttaaacaccctggtcgacCAGTTCGAGTTTATCATTATC...

Embodiment 2

[0088] Embodiment 2 error-prone PCR method constructs hydroxylase random mutant library

[0089] Using the plasmid pYES2.1-DMDH-CPR2 obtained in Example 1 as a template, an error-prone PCR technique was used to construct a random mutant library, and the primer pairs used were as follows:

[0090] Forward primer Errorpcr-F: ATGGTTTTGTTCTTTTTCTTT,

[0091] Reverse primer Errorpcr-R: AATTATGTGGATGTAAATGT.

[0092] 50μL error-prone PCR reaction system includes: 50ng plasmid template pYES2.1-DMDH-CPR2, 30pmol pair of primers Errorpcr-F and Errorpcr-R, 1X Taq buffer, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, 1mMdTTP, 7mM MgCl 2 , (0mM, 0.05mM, 0.1mM, 0.15mM, 0.2mM) MnCl 2 , 2.5 units of Taq enzyme (Fermentas). The PCR reaction conditions were: 95°C for 5min; 94°C for 30s, 55°C for 30s, 72°C for 2min / kbp; 30 cycles; 72°C for 10min. The 1.5kb random mutation fragment was recovered from the gel as a large primer, and MegaPrimer PCR was performed with KOD-plus DNA polymerase: 94°C for 5min;...

Embodiment 3

[0093] Expression and preparation of embodiment 3 hydroxylase

[0094] The expression host was Saccharomyces cerevisiae BY4742MATa his3Δ1leu2Δ0met15Δ0ura3Δ0 strain. References for transformation, expression and preparation of enzyme solutions (Han, J.-Y., H.-S.Hwang, S.-W.Choi, H.-J.Kim and Y.E.Choi. Cytochrome P450 CYP716A53v2Catalyzes the Formation ofProtopanaxatriol from Protopanaxadiol During Ginsenoside Biosynthesis inPanax Ginseng.Plant Cell Physiol.2012,53(9):1535–1545.), the specific method is as follows:

[0095] The host strain BY4742 was streaked on the YPD solid medium, cultured at 30°C for 2 days, and a single colony was picked and transferred to a test tube containing 4ml of YPD liquid medium. Cultivate overnight at 30°C and 220rpm, transfer to a 250ml shake flask filled with 25ml YPD liquid medium, cultivate at 30°C and 220rpm for 4-6 hours, and cultivate to OD 600 0.8-1.0, the bacterial solution is used to prepare the transformation competence of Saccharomyce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention obtains a hydroxylase mutant SEQ ID Nos:3-4 with the enzyme activity improved by means of directed evolution, the mutant or an expressed microorganism can efficiently catalyze dammarenediol to prepare protopanoxadiol through a hydroxylation reaction, and the hydroxylase mutant has industrial development and application prospects.

Description

technical field [0001] The invention belongs to the field of biocatalysis and relates to a hydroxylase mutant, in particular to a dammarenediol hydroxylase mutant and its application in synthesizing protopanaxadiol. Background technique [0002] Ginsenoside is a general term for the saponins isolated from ginseng and its congeners (such as Panax notoginseng, American ginseng, etc.), belonging to triterpenoid saponins, and is the main active ingredient in ginseng. At present, at least 60 saponins have been isolated from ginseng, some of which have been proven to have a wide range of physiological functions and medicinal value: including anti-tumor, immune regulation, anti-fatigue, heart protection, liver protection and other functions. According to the form of aglycone, ginsenosides are generally classified into three types, oleanane type, protopanaxadiol type (PPD type) and protopanaxatriol type (PPT type). Protopanaxadiol (protopanaxadiol, PPD) is an important precursor fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12N1/19C12P33/06C12R1/865
CPCC12N9/0073C12N15/81C12P33/06
Inventor 范文超高书良王金刚梁岩袁圣伦任亮
Owner ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap