Gene for improving chlorophyll synthesis and photosynthesis efficiency of tomatoes and application

A photosynthetic efficiency and chlorophyll technology, which is applied in the fields of molecular biology, physiology, and genetic engineering, can solve the problems of the influence and regulation mechanism of tomato chlorophyll synthesis and photosynthetic efficiency, and has not yet been reported, and achieves the effect of good application value.

Active Publication Date: 2019-04-16
SHENYANG AGRI UNIV
View PDF5 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have reported that HY5 can increase the content of secondary metabolites such as flavonoids and anthocyanins in plants, indicating that light signals have an important effect on the content of plant metabolites. The impact and regulation mechanism have not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for improving chlorophyll synthesis and photosynthesis efficiency of tomatoes and application
  • Gene for improving chlorophyll synthesis and photosynthesis efficiency of tomatoes and application
  • Gene for improving chlorophyll synthesis and photosynthesis efficiency of tomatoes and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: HY5 Construction of gene overexpression vector

[0034] In order to clarify the regulation mechanism of light signal on chlorophyll synthesis in tomato plants, the total RNA of tomato leaves was extracted and cDNA was obtained by reverse transcription. Using the cDNA as a template, cloned HY5 Gene.

[0035] clone HY5 Specific methods for gene and construction of overexpression vector: According to the sequence analysis of the coding region, design specific primers and add restriction enzyme sites to the primers ( Asc I and Sal I), primers HY5 -OE-F and HY5 The sequences of -OE-R are respectively ttggcgcgcc atgcaagagc aagcgacgag (shown in SEQ ID NO: 3) and acgcgtcgaccttcctccct tcctgtgcac (shown in SEQ ID NO: 4). PCR cloning with PrimerSTAR high-fidelity enzyme (Beijing Tiangen Technology Co., Ltd.) HY5 fragment, and then double-digest the PCR cloned fragment and the pFGC1008-HA vector (obtained from BioVector NTCC China Plasmid Vector Strain Cel...

Embodiment 2

[0056] Example 2: tomato HY5 Construction and detection of overexpression transgenic material

[0057] The overexpression vector pFGC1008::SlHY5-HA was transformed into Agrobacterium EHA105, and the cotyledons of tomato (variety Ailsa Craig: purchased from the World Tomato Genetic Resource Center, http: / / tgrc.ucdavis.edu) were infected by plant tissue culture Technology, callus induction, resistance induction differentiation and rooting culture to obtain tissue culture shoots (Fillatti et al., 1987), T2 generation seeds were tested for chloramphenicol resistance, 3 / 4 were selected for resistance and the remaining 1 / 4 strain without resistance, indicating that the overexpression vector with the target gene was inserted in a single copy form in this strain. These plants were removed and harvested individually. Validation by Western Blot HY5 Overexpression positive transgenic plants (Wang et al., 2015), the results showed that the wild type had no protein band, while the ov...

Embodiment 3

[0058] Example 3: tomato HY5 Detection of Chlorophyll Content and Photosynthetic Efficiency in Transgenic Materials

[0059] Tomato seedling plants were cultivated in an artificial climate chamber, during which the day and night temperature was 25°C / 20°C, the light time was 12h, and the light intensity was 600μmol m -2 the s -1 . When the tomato seedlings grow to five leaves and one heart, detect wild-type tomato seedlings (WT) and the results obtained in Example 2. HY5 Chlorophyll content of gene overexpression lines ( figure 2 ; Zhang et al., 2016), the maximum photochemical efficiency of photosystem Ⅱ (ΦPSII, image 3 A; Zhang et al., 2014; Li et al., 2016b) and photosynthetic rate (Pn, image 3 B; Zhang et al., 2014; Li et al., 2016b), the results showed that compared with wild-type tomato (WT), HY5 Gene overexpression significantly increased the chlorophyll content in tomato leaves ( figure 2 ), at the same time, both ΦPSII and Pn were significantly increased...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a gene for improving chlorophyll synthesis and photosynthesis efficiency of tomatoes and application. The gene for improving the chlorophyll synthesis and photosynthesis efficiency of the tomatoes is composed of a tomato S1HY5 gene and protein encoded by the gene. The invention provides the application of the tomato S1HY5 gene or the protein encoded by the tomato SlHY5 gene to the improvement of chlorophyll synthesis of tomato plants and promotion of the photosynthesis of tomato plant leaves and a method for obtaining the transgenic tomato plants with the increased plant chlorophyll and photosynthesis rate. According to the specific method, through a gene overexpression technology, the expression level of the tomato S1HY5 gene is increased, and therefore the chlorophyll of the tomato plants is increased; the functions of increasing the chlorophyll content of the tomatoes and improving the photosynthesis efficiency of the tomatoes are determined, a gene resourceis provided for cultivating the new tomato varieties with the high chlorophyll content, the gene has high application value, and a theoretical basis is laid for a regulation mechanism of optical signals for the chlorophyll synthesis and photosynthesis of the plants.

Description

technical field [0001] The invention relates to the fields of genetic engineering, molecular biology, physiology and the like, in particular to a gene and application for promoting tomato chlorophyll synthesis and photosynthetic efficiency. Background technique [0002] Tomato is an annual or perennial herbaceous plant in the genus Solanum of the family Solanaceae, and it is one of the most widely cultivated and consumed vegetable crops in the world. Improving yield and quality of tomatoes is critical to the variety and variety of tomato varieties, as well as their high nutritional value (such as lycopene, which protects against cancer), and consumer preference. Tomatoes originated in subtropical regions and are light-loving and warm-loving plants. However, in facility production, low temperature and weak light occur frequently, which severely limits the yield of tomato and other horticultural crops. Therefore, studying the mechanism of light’s influence on tomato chlorophy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/02C12N15/82C07K14/415A01H5/00A01H6/82
CPCC12N15/825C12N15/8269C07K14/415
Inventor王峰李天来闫家榕向恒佐齐明芳齐红岩
OwnerSHENYANG AGRI UNIV