Method, engineering bacteria and application of microbial fermentative production of glutaractone

A microbial fermentation and production engineering technology, applied in the field of microbial fermentation to produce glutaractone, can solve the problems of many by-products, high price of related steroid drugs, high production cost, etc., to block the formation of by-products and improve the conversion rate of substrates , the effect of reducing production costs

Active Publication Date: 2022-03-11
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the molar yields achieved by these existing glutaractone fermentation production strains are still low, and there are many by-products, resulting in difficulties in separation and purification and high production costs, which lead to high prices for related steroid drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, engineering bacteria and application of microbial fermentative production of glutaractone
  • Method, engineering bacteria and application of microbial fermentative production of glutaractone
  • Method, engineering bacteria and application of microbial fermentative production of glutaractone

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Embodiment 1: Construction of gene knockout plasmid

[0082] The nucleotide sequence of fatty acid coenzyme A / carboxylate reductase 1 (car1) is shown in SEQ ID NO:1, and the nucleotide sequence of fatty acid coenzyme A / carboxylate reductase 2 (car2) is shown in SEQ ID NO:3 Show. The plasmids for knocking out car1 and the plasmids for knocking out car2 were respectively constructed according to the following methods.

[0083] Car1 and car2 were used as templates for PCR amplification. The PCT system and primers are as follows.

[0084] PCR system:

[0085]

[0086] PCR program: 3 minutes at 98°C; denaturation at 98°C for 10 seconds, annealing at 58°C for 20 seconds, extension at 72°C for 30 seconds, 30 cycles; 10 minutes at 72°C. The primer sequences used are:

[0087] For car1:

[0088] Upstream fragment primers:

[0089] Up-F: 5'TGTTGCCATTGCTGCAGGCATCTCGCACCATCAGC 3' (SEQ ID NO: 5)

[0090] Up-R: 5'AGGTCACTTGGTCGAGCCAGCGCCGCCTGATTCTC 3' (SEQ ID NO: 6)

[00...

Embodiment 2

[0102] Example 2: Screening of knockout strains

[0103] The constructed gene knockout plasmid was electrotransformed into Mycobacterium fortuitum (obtained from the American Type Culture Collection (ATCC), strain number: ATCC6841) competent cells, and coated with Kan-resistant LB plates (pancreatic Peptone: 10g / L, yeast extract: 5g / L, sodium chloride: 10g / L, Kan: 50μg / ml, agar: 1.6%) and add IPTG and X-gal for the first screening. Pick blue single colony from it to sucrose plate (tryptone: 10g / L, yeast extract: 5g / L, sucrose: 10g / L, agar: 1.6%) (add IPTG and X-gal), carry out the second time filter. Pick the white colony on the sucrose plate to the liquid LB medium, culture at 30°C for about 36 hours, extract the genome, and use the Up-F and Down-R primers of the target gene for PCR verification. If the gene knockout is successful, the PCR product should be a single fragment of about 2kbp. Figure 5 showed that a mycobacterial strain with car2 gene knockout was successfull...

Embodiment 3

[0104] Embodiment 3: fermentation produces glutaractone

[0105] Seed medium:

[0106] Glucose: 6g / L; Yeast powder: 15g / L; NaNO 3 : 5.4g / L; Glycerin: 2g / L; NH 4 h 2 PO 4 : 0.6g / L; pH: 7.5; sterilized at 115°C for 30 minutes.

[0107] Fermentation medium:

[0108] NaNO 3 : 6.37g / L; KH 2 PO 4 : 1.05g / L; Na 2 HPO 4 : 2.14g / L; MgSO 4 : 0.82g / L; KCl: 0.21g / L; CaCl 2 : 0.1g / L; corn steep liquor dry powder: 14.23g / L; phytosterols: 20g / L; soybean oil: 12%; pH: 7.8; sterilized at 121°C for 30 minutes.

[0109] Fermentation culture steps:

[0110] LB plates (tryptone: 10g / L, yeast extract: 5g / L, sodium chloride: 10g / L, agar: 1.6%) were cultured for 72 hours at 30°C to activate the strains, and activate the bismuth obtained in Example 2 respectively. Knockout strains and wild-type mycobacterial strains (ATCC 6841);

[0111] Inoculate the bacteria from the activated plate into the seed medium, culture at 180 rpm, 30°C for 3 days, and obtain the seed liquid;

[0112] Sampli...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing glutaractone through microbial fermentation, an engineering bacterium for producing glutaractone and application thereof. The method for producing glutaractone by microbial fermentation comprises utilizing glutaractone-producing bacteria to produce glutaractone by sterol fermentation, it is characterized in that, the described glutaractone-producing bacteria has at least one fatty acid coenzyme A / carboxylic acid reductase, and this enzyme can catalyze The reaction i of the following compounds I to II, and the method includes inhibiting the activity and / or expression of at least one of the fatty acid coenzyme A / carboxylate reductase in the glutaractone-producing bacteria, the reaction is: wherein , "-X" is hydroxyl or carbonyl; "-Y" is hydroxyl or "-SCoA". The invention can improve the conversion rate of the substrate during the fermentative production of glutaractone, reduce or block the generation of by-products, make the products easy to separate and purify, and reduce the production cost.

Description

technical field [0001] The invention belongs to the field of microbial fermentation, and specifically relates to a method for producing glutaractone by microbial fermentation, engineering bacteria and applications. Background technique [0002] Steroids (also known as sterols) are a class of compounds with a cyclopentane polyhydrophenanthrene ring structure, usually with methyl groups at the C-10 and C-13 positions and an alkyl side chain at the C-17 position. Its structural formula is shown in the following formula III. Steroids, as a component of cell membranes, play an important role in living organisms. Some steroids also act as hormones and signaling molecules. Since the discovery of steroid drugs in the 1950s, more than 300 steroid drugs have been identified so far. Steroidal drugs have strong pharmacological effects such as anti-infection, anti-allergy, anti-virus and anti-shock. In recent years, the application range of steroid drugs in the medical field has been...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P7/26C12N1/21C12R1/01C12R1/38C12R1/32C12R1/465C12R1/06
Inventor冯进辉陈曦姚培圆刘娜张瑞李雪梅吴洽庆朱敦明马延和张峥斌
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI