Rapid PCR amplification kit for yeast colonies and method for performing PCR amplification on yeast colonies by using kit

A yeast and kit technology, applied in the field of bioengineering, can solve the problems of genome release PCR amplification failure, cumbersome operation, increase experimental cost and other problems, and achieve the effect of realizing rapid PCR amplification, reducing cross-contamination, and easy to popularize and use.

Pending Publication Date: 2019-06-04
广州睿辰生物科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When performing colony PCR with traditional bacteria, you can directly pick a single bacterial colony or a bacterial solution, but yeast is different from bacteria, and its cell wall is difficult to break. Improper treatment and insufficient genome release will cause PCR amplification failure.
[0003] When performing PCR amplification on the yeast gene, the traditional method is to extract the total genome of the yeast and then perform PCR amplification. This method can obtain a relatively high-purity genome for PCR amplification and the amplification effect is ideal. However, for the conversion rate of yeast, researchers may need to screen and identify more colonies. Extracting the genome will not only take a lot of time and increase the cost of the experiment, but also in the process of genome extraction, due to the large number of samples, the operation is slightly inconvenient. If you are careful, it will cause cross-contamination between samples, which will bring troubles to subsequent experiments.
[0004] At present, yeast colony PCR technology is widely used, which eliminates the cumbersome steps of genome extraction, mainly pre-processing the cell wall of yeast, including repeated freezing and thawing to break the wall, enzyme digestion treatment, high-temperature cooking, and extended PCR. Pre-denaturation time, etc. Although the yeast treated by these methods can effectively perform PCR amplification, the pretreatment time is relatively long, the operation is cumbersome, and the stability and amplification need to be further improved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid PCR amplification kit for yeast colonies and method for performing PCR amplification on yeast colonies by using kit
  • Rapid PCR amplification kit for yeast colonies and method for performing PCR amplification on yeast colonies by using kit
  • Rapid PCR amplification kit for yeast colonies and method for performing PCR amplification on yeast colonies by using kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] A yeast colony rapid PCR amplification kit, including: 10× lysate, 10× PCR reaction solution, dNTP, hot start Taq enzyme;

[0030] The ingredients contained in every liter of 10× lysate are: 20mM KOH, 1.5% (w / v) sodium lauryl sulfate, 60% (v / v) polyethylene glycol;

[0031] The components contained in every liter of 10×PCR reaction solution are: 100mM Tris-HCl, 500mM KCl, 15 mM MgCl2, 0.01% (w / v) gelatin, 0.1% (v / v) polyethylene glycol octyl phenyl ether , pH 8.3 at 25°C.

Embodiment 2

[0033] Utilize the method for PCR amplification Pichia GS115 colony GAP gene of yeast bacterium colony rapid PCR amplification kit in embodiment 1, comprise the following steps:

[0034] (1) Take 500ul of fresh bacterial liquid cultured by Pichia pastoris GS115 monoclonal colony, centrifuge at 13,000 rpm for 20s, discard the supernatant, add 200μL of cell lysate to the centrifuge tube, and use a micro-vortexer to vortex for 15s to make the bacteria and After fully mixing the lysate, let it stand at room temperature for 3 minutes, centrifuge at 13,000 rpm for 30 seconds at 4°C, and use the supernatant for later use.

[0035] (2) Prepare the PCR reaction system including: 2.5 μL of 10×PCR reaction solution, 2.5 mM dNTP, 2.5 μL, 1 μL of 10 umol upstream and downstream primers, 2.5 μL of lysed supernatant, 1 μL of hot-start Taq enzyme, and make up to 25 μL with double distilled water ;

[0036] The upstream primer sequence is: TTCAAGCAGCGTCACTCCTC;

[0037] The downstream primer...

Embodiment 3

[0042] Utilize the yeast bacterium colony rapid PCR amplification kit PCR amplification method in embodiment 1 Pichia GS115 bacterial colony exogenous pYES2-GFP carrier, comprise the following steps:

[0043] (1) Take 500ul of fresh bacterial liquid cultured by Pichia pastoris GS115 monoclonal colony, centrifuge at 13,000 rpm for 20s, discard the supernatant, add 200μL of cell lysate to the centrifuge tube, vortex for 15s to fully mix the bacteria and the lysate Afterwards, let stand at room temperature for 3 minutes, centrifuge at 13,000 rpm for 30 seconds at 4°C, and use the supernatant for later use.

[0044] (2) Prepare the PCR reaction system including: 2.5 μL of 10×PCR reaction solution, 2.5 μL of 2.5mM dNTP, 1 μL of 10 μmol upstream and downstream primers, 2.5 μL of lysed supernatant, 1 μL of hot-start Taq enzyme, supplemented with double distilled water to 25 μL;

[0045] The fragment amplified in this example uses pYES2-GFP universal sequencing primer, the upstream p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid PCR amplification kit for yeast colonies and a method for performing PCR amplification on the yeast colonies by using the kit. The kit comprises: 10 x cell lysis buffer, 10 x PCR reaction solution, dNTP and hot-start Taq enzyme. Compared with the prior art, the kit does not need the genome extraction steps of heating, boiling, phenol / chloroform extraction, and the like, so that the toxicity of toxic substances to experimental personnel is reduced. The method has quick and simple operation and saves a great deal of time. The method directly lyses monoclonal colonies, reduces cross pollution, and avoids false positivity. By using the cell wall lysis buffer with high pH value, the cell wall of the yeast can be effectively lysed in a short time, the yeast genomecan be fully released, the pH value of the released supernatant after being mixed with the matched PCR reaction solution is within a proper range of PCR amplification, and the rapid PCR amplificationcan be realized.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a yeast colony rapid PCR amplification kit and a method for using the kit to PCR amplify yeast colonies. Background technique [0002] Yeast is a kind of fungal microorganism, which is widely distributed in nature and is a typical facultative anaerobic microorganism. It can ferment sugar into alcohol and carbon dioxide ponds, and is widely used in the food field. Secondly, as an important engineering bacterium, It is widely used in the molecular field, for example in the field of molecular cloning as eukaryotic recipient cells. In yeast molecular cloning, PCR is required to verify whether the exogenous gene has been successfully transformed after the transformation of the exogenous gene into the yeast. When performing colony PCR with traditional bacteria, you can directly pick a single bacterial colony or a bacterial solution, but yeast is different from bacte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/686C12Q1/04
Inventor周辉
Owner广州睿辰生物科技有限公司