Method for identifying specific site interaction RNA based on CRISPR/cas9 and APEX2 system

A technology for identifying specificity and loci, which can be applied in the biological field and can solve problems such as the inability to provide natural chromatin or genome-wide functional analysis.

Pending Publication Date: 2019-07-02
FUDAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Additionally, these methods do not specifically provide functional analysis of native chromatin or genome-wide

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying specific site interaction RNA based on CRISPR/cas9 and APEX2 system
  • Method for identifying specific site interaction RNA based on CRISPR/cas9 and APEX2 system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Construction and transfection of embodiment 1 plasmid expression vector

[0031] 1.1 Construction of the plasmid expression vector: In order to construct the MS2-APEX2_NLS fusion protein expression vector, APEX2 was amplified from the pcDNA3Connexin43-GFP-APEX2 (Addgene plasmid: 49385) plasmid by PCR, and then digested with BamHI and XhoI, Cloned into the pHAGE-EFS-MCP-3XBFPnls (Addgene plasmid: 75384) vector. The pLH-sgRNA1-2XMS2 (Addgene plasmid: 75389) plasmid was digested with BbsI and ligated with the annealed oligonucleotide fragment to obtain a plasmid expressing sgRNA. The plasmid expressing dCas9 was obtained from Addgene:64107. The sgRNA sequence is shown in Table 1:

[0032] Table 1 sgRNA sequence

[0033] target Sequence(5'-3') sgRNA-Telomere TAGGGTTAGGGTTAGGGTTA (SEQ ID NO 1) sgRNA-Gal4 AACGACTAGTTAGGCGTGTA (SEQ ID NO2)

[0034] 1.2 HEK293T cell culture: HEK293T cells were cultured in a 5% CO2 and 37°C incubator, and the me...

Embodiment 2

[0036] Example 2 Enrichment and detection of telomeric region RNA

[0037] 2.1 After the cells were transfected for 24 hours, the cells were treated with 500 uM biotin-phenol (Iris Biotech GmbH, Germany) in an incubator for 30 min, then hydrogen peroxide was added to a final concentration of 1 mM, and the cells were treated at room temperature for 1 min. Immediately thereafter, reaction termination solution (10 mM sodium azide, 10 mM Vc, 5 mM Trolox) was added to terminate the reaction, and washed three times. After terminating the reaction, fix with 0.2% formaldehyde for 10 minutes, and terminate the reaction with glycine.

[0038]2.2 Add 1x PIC, 100U / ml RNasin, 5mM EDTA, 0.5mM DTT to the buffers used below. Lyse the cells with 1 mL of Hypotonic buffer (20mM HEPES pH7.5, 10mM potassium chloride, 1mM EDTA, 0.1mM activated sodium orthosclerate, 0.2% NP-40, 10% glycerol) for 15min, centrifuge at 13000g for 1min at 4°C, Discard the supernatant. The cell pellet was resuspended ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and relates to a method for identifying specific site interaction RNA. Based on a CRISPR / cas9 and peroxidase APEX2 system, the method comprises thesteps: plasmid transformation, wherein plasmids include plasmids expressing dcas9 proteins, sgRNA specific sequences or peroxidase APEX2 respectively; biotin labelling of proteins by APEX2; enrichment of biotin-labeled proteins, DNA or RNA complexes by streptomycin magnetic beads; extraction and purification of RNA; and reverse transcription and analysis of enriched RNA. The method is simple to operate, high in specificity, good in reproducibility and suitable for the study of interaction RNA at any given chromosome position.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for studying the interaction RNA of a specific genomic site based on a CRISPR / cas9 and peroxidase APEX2 system. Background technique [0002] In eukaryotic cells, DNA molecules are highly organized and tightly wrapped around repeating units of nucleosomes to form chromatin. However, in living cells, the structure of chromatin is dynamically changing, and localized chromatin can be accessed by regulatory elements such as transcription factors and non-coding RNAs. In recent years, many mechanisms regulating chromatin organization have been proposed, for example, each chromosome in the nucleus of eukaryotic cells is located in a specific region called a chromosome region, which contains many structures, usually several million bases in size Domains, called topological domains; in topological domains, distal DNA elements regulate gene expression through dynamic inte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N15/90C12Q1/6806
CPCC12N15/85C12N15/907C12Q1/6806C12N2800/107C12N2810/10
Inventor刘贇邱文青
OwnerFUDAN UNIV