Method for identifying specific site interaction RNA based on CRISPR/cas9 and APEX2 system
A technology for identifying specificity and loci, which can be applied in the biological field and can solve problems such as the inability to provide natural chromatin or genome-wide functional analysis.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Construction and transfection of embodiment 1 plasmid expression vector
[0031] 1.1 Construction of the plasmid expression vector: In order to construct the MS2-APEX2_NLS fusion protein expression vector, APEX2 was amplified from the pcDNA3Connexin43-GFP-APEX2 (Addgene plasmid: 49385) plasmid by PCR, and then digested with BamHI and XhoI, Cloned into the pHAGE-EFS-MCP-3XBFPnls (Addgene plasmid: 75384) vector. The pLH-sgRNA1-2XMS2 (Addgene plasmid: 75389) plasmid was digested with BbsI and ligated with the annealed oligonucleotide fragment to obtain a plasmid expressing sgRNA. The plasmid expressing dCas9 was obtained from Addgene:64107. The sgRNA sequence is shown in Table 1:
[0032] Table 1 sgRNA sequence
[0033] target Sequence(5'-3') sgRNA-Telomere TAGGGTTAGGGTTAGGGTTA (SEQ ID NO 1) sgRNA-Gal4 AACGACTAGTTAGGCGTGTA (SEQ ID NO2)
[0034] 1.2 HEK293T cell culture: HEK293T cells were cultured in a 5% CO2 and 37°C incubator, and the me...
Embodiment 2
[0036] Example 2 Enrichment and detection of telomeric region RNA
[0037] 2.1 After the cells were transfected for 24 hours, the cells were treated with 500 uM biotin-phenol (Iris Biotech GmbH, Germany) in an incubator for 30 min, then hydrogen peroxide was added to a final concentration of 1 mM, and the cells were treated at room temperature for 1 min. Immediately thereafter, reaction termination solution (10 mM sodium azide, 10 mM Vc, 5 mM Trolox) was added to terminate the reaction, and washed three times. After terminating the reaction, fix with 0.2% formaldehyde for 10 minutes, and terminate the reaction with glycine.
[0038]2.2 Add 1x PIC, 100U / ml RNasin, 5mM EDTA, 0.5mM DTT to the buffers used below. Lyse the cells with 1 mL of Hypotonic buffer (20mM HEPES pH7.5, 10mM potassium chloride, 1mM EDTA, 0.1mM activated sodium orthosclerate, 0.2% NP-40, 10% glycerol) for 15min, centrifuge at 13000g for 1min at 4°C, Discard the supernatant. The cell pellet was resuspended ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com