Unlock instant, AI-driven research and patent intelligence for your innovation.

A site-directed mutation Aspergillus niger 6-4 photorepair enzyme and its construction method

A site-directed mutagenesis, photorepair enzyme technology, applied in the fields of bioengineering, gene, and protein engineering, can solve the problem of scarcity of 6-4 photorepair enzyme research, and achieve the effect of maintaining lasting stability and improving enzyme activity.

Active Publication Date: 2020-02-21
ANHUI NORMAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the past, researchers have done a lot of research on CPD photorepair enzymes, but the research on 6-4 photorepair enzymes is relatively scarce

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A site-directed mutation Aspergillus niger 6-4 photorepair enzyme and its construction method
  • A site-directed mutation Aspergillus niger 6-4 photorepair enzyme and its construction method
  • A site-directed mutation Aspergillus niger 6-4 photorepair enzyme and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1: the acquisition of mutant enzyme S460N gene and the construction of expression vector

[0037] 1. Obtain WT Aspergillus niger photorepair enzyme gene

[0038] Find the Aspergillus niger photorepair enzyme (WT) gene sequence in Genbank (GeneBank accession XP_001397458.2), optimize it based on the codon bias in Escherichia coli (E.coli), and design a gene suitable for expression in Escherichia coli (An6 -4), the gene was artificially synthesized by Shanghai Jierui Biological Co., Ltd., and loaded into the pET22b plasmid vector. After the company's sequencing was successful, the successfully constructed recombinant plasmid pET22b-An6-4 (Zheng Binqiong. Escherichia coli synonymous code) was sent back An overview of sub-preferences [J]. Silicon Valley, 2009 (01): 23-24.).

[0039] 2. Construction of mutant strains

[0040] Design a pair of mutation primers, the mutation primers are:

[0041] S460NF: 5'ATCATGAAACCGCAAATAATGTGGGTAATTGGATGTGGCTG 3'

[0042] S4...

Embodiment 2

[0060] Example 2: Expression and purification of mutant enzyme S460N

[0061] 1. Expression of mutant enzyme S460N

[0062] Pick the engineered bacteria Rosetta(DE3) / pET22b-S460N, inoculate it in 5ml LB liquid medium resistant to ampicillin and chloramphenicol, shake the bacteria at 225rpm at 37°C, and expand the culture overnight. The next day, transfer 2ml of the culture to 200ml of liquid LB containing the corresponding antibiotics, 37°C, 225rpm, shake culture to OD 600 to about 1; remove the bacteria from the shaker and cool to room temperature. Add 1mM isopropyl-β-D-thiogalactopyranoside (isopropyl-β-D-thiogalactopyranoside, IPTG), 20°C, 225rpm, induce expression for 20h; add 200ml of the expanded culture to 50ml in four times In the centrifuge tube, centrifuge at 5500rpm, 4°C, 5min to collect the bacteria.

[0063] 2. Purification of mutant enzyme S460N

[0064] LEW Buffer (500ml)

[0065]

[0066] Elution Buffer (500ml):

[0067]

[0068] Take 5ml of bacteri...

Embodiment 3

[0070] Example 3: Detection of Enzyme Activity of Mutant Enzyme S460N and WT Photorepair Enzyme

[0071] Thymine irradiated by ultraviolet light will produce a 6-4 photoproduct, and the pyrimidine dimer has a characteristic absorption at 325nm. Through 300nm-400nm near-ultraviolet visible light irradiation, Aspergillus niger photorepair enzyme cracks and reduces 6-4 photoproducts, so that the absorbance at 325nm will gradually decrease. Therefore, the activity of the protein repair 6-4 photoproduct can be detected by the decrease speed of the light absorption value at 325nm, that is, the amount of substrate reduction per unit time.

[0072] At room temperature, use a 254nm ultraviolet lamp at a lamp distance of 1cm to irradiate the artificially synthesized oligonucleotide solution (Shanghai Jierui) containing 16 thymine bases for 5 hours to obtain an oligomer nucleus containing 6-4 photoproducts A solution of nucleotides, namely UV-DT16. The reaction system is 600 μL, includ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Aspergillus niger 6-4 photolyase with site-specific metagenesis and a construction method thereof. The Aspergillus niger 6-4 photolyase with site-specific metagenesis has a nucleotide sequence shown as SEQ ID NO: 1. A 6-4 photolyase gene sequence acquired from existing WT Aspergillus is subjected to artificial codon optimization; a metagenesis primer is designed to acquirea metagenetic gene fragment; the gene fragment is linked with pET22b plasmid to construct a recombinant expression plasmid; the recombinant expression plasmid is converted to Escherichia coli competent cells to construct a genetically engineered bacterium for photolyase expression, which is well expressed under 20 DEG C and 1 mM IPTG. Compared with WT photolyase, the mutant enzyme S60N expressed herein has higher activity which is stably maintained longer, can better restore DNA damage caused by ultraviolet, and can be more easily used as cosmetics, and pharmaceutical additives in people's daily lives.

Description

Technical field: [0001] The invention belongs to the technical field of bioengineering, relates to the technical field of gene and protein engineering, in particular to an Aspergillus niger DNA photorepair enzyme gene and a construction method thereof. Background technique: [0002] With the development of science and technology, human activities to destroy nature have intensified, causing the ozone layer in the atmosphere to thin or even create holes, and the ability to block ultraviolet rays is weakened. As a result, the dose of medium-wave ultraviolet (UVB, 280nm-315nm) reaching the earth's surface is gradually increased, which leads to a great increase in the incidence of human skin damage. The principle is that UVB can be directly absorbed by skin cell DNA, causing two adjacent thymines on the DNA to produce stable covalently bonded dimers, including cyclobutane pyrimidine dimer (CPD) and 6-4 photoproduct ( 6-4photoproduct), these two types of dimers destroy the normal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/70
CPCC12N9/00C12N15/70C12N2800/22
Inventor 朱国萍文斌王胜地徐蕾王鹏黄士平曹正宇汪源卞命杰
Owner ANHUI NORMAL UNIV