A site-directed mutation Aspergillus niger 6-4 photorepair enzyme and its construction method
A site-directed mutagenesis, photorepair enzyme technology, applied in the fields of bioengineering, gene, and protein engineering, can solve the problem of scarcity of 6-4 photorepair enzyme research, and achieve the effect of maintaining lasting stability and improving enzyme activity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1: the acquisition of mutant enzyme S460N gene and the construction of expression vector
[0037] 1. Obtain WT Aspergillus niger photorepair enzyme gene
[0038] Find the Aspergillus niger photorepair enzyme (WT) gene sequence in Genbank (GeneBank accession XP_001397458.2), optimize it based on the codon bias in Escherichia coli (E.coli), and design a gene suitable for expression in Escherichia coli (An6 -4), the gene was artificially synthesized by Shanghai Jierui Biological Co., Ltd., and loaded into the pET22b plasmid vector. After the company's sequencing was successful, the successfully constructed recombinant plasmid pET22b-An6-4 (Zheng Binqiong. Escherichia coli synonymous code) was sent back An overview of sub-preferences [J]. Silicon Valley, 2009 (01): 23-24.).
[0039] 2. Construction of mutant strains
[0040] Design a pair of mutation primers, the mutation primers are:
[0041] S460NF: 5'ATCATGAAACCGCAAATAATGTGGGTAATTGGATGTGGCTG 3'
[0042] S4...
Embodiment 2
[0060] Example 2: Expression and purification of mutant enzyme S460N
[0061] 1. Expression of mutant enzyme S460N
[0062] Pick the engineered bacteria Rosetta(DE3) / pET22b-S460N, inoculate it in 5ml LB liquid medium resistant to ampicillin and chloramphenicol, shake the bacteria at 225rpm at 37°C, and expand the culture overnight. The next day, transfer 2ml of the culture to 200ml of liquid LB containing the corresponding antibiotics, 37°C, 225rpm, shake culture to OD 600 to about 1; remove the bacteria from the shaker and cool to room temperature. Add 1mM isopropyl-β-D-thiogalactopyranoside (isopropyl-β-D-thiogalactopyranoside, IPTG), 20°C, 225rpm, induce expression for 20h; add 200ml of the expanded culture to 50ml in four times In the centrifuge tube, centrifuge at 5500rpm, 4°C, 5min to collect the bacteria.
[0063] 2. Purification of mutant enzyme S460N
[0064] LEW Buffer (500ml)
[0065]
[0066] Elution Buffer (500ml):
[0067]
[0068] Take 5ml of bacteri...
Embodiment 3
[0070] Example 3: Detection of Enzyme Activity of Mutant Enzyme S460N and WT Photorepair Enzyme
[0071] Thymine irradiated by ultraviolet light will produce a 6-4 photoproduct, and the pyrimidine dimer has a characteristic absorption at 325nm. Through 300nm-400nm near-ultraviolet visible light irradiation, Aspergillus niger photorepair enzyme cracks and reduces 6-4 photoproducts, so that the absorbance at 325nm will gradually decrease. Therefore, the activity of the protein repair 6-4 photoproduct can be detected by the decrease speed of the light absorption value at 325nm, that is, the amount of substrate reduction per unit time.
[0072] At room temperature, use a 254nm ultraviolet lamp at a lamp distance of 1cm to irradiate the artificially synthesized oligonucleotide solution (Shanghai Jierui) containing 16 thymine bases for 5 hours to obtain an oligomer nucleus containing 6-4 photoproducts A solution of nucleotides, namely UV-DT16. The reaction system is 600 μL, includ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



