Streptococcus salivarius and application thereof to preparation of medicines for treatment of inflammatory bowel diseases

A technology for Streptococcus salivarius and inflammatory bowel disease, applied in the biological field, can solve the problems of poor understanding of strains, shortage of healthy donors, and in-depth research on intestinal flora, so as to reduce intestinal mucosal damage and improve intestinal inflammation Effect

Inactive Publication Date: 2019-11-15
XIAMEN UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is a shortage of healthy donors for intestinal bacteria transplantation. [3]
[0005] So far, the mechanism of intestinal flora has not been studied in depth in the field of basic research, and there is not much understanding of the strains that can specifically play a beneficial role in the treatment process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptococcus salivarius and application thereof to preparation of medicines for treatment of inflammatory bowel diseases
  • Streptococcus salivarius and application thereof to preparation of medicines for treatment of inflammatory bowel diseases
  • Streptococcus salivarius and application thereof to preparation of medicines for treatment of inflammatory bowel diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Isolation and identification of Streptococcus salivarius

[0024] Take feces samples from healthy people, make a gradient dilution of 10^-1 to 10^-10 with sterilized water, plate on BHI solid medium with sterile glass rods, and incubate at 37° for 2 to 3 days.

[0025] Use a sterile inoculation loop to pick a single colony. After purification and passage for 3 times, pick a single colony and transfer it into 5ml of BHI liquid medium, cultivate overnight at 37°C take 1mL of the bacterial solution, centrifuge at 12000g / min for 10min, discard the supernatant, and use the whole Bacterial DNA was extracted using the EasyPure GenomicDNA Kit (EE101).

[0026] PCR amplification: amplification reaction system:

[0027] Amplification system (50μL):

[0028] 2×EasyTaq PCR SuperMix 25 μL DNA template 2μL pre-primer 1μL back primer 1μL Ultra-pure water 21μL

[0029] Primer sequence:

[0030] Front primer, 27F: 5'-AGAGTTTGATC...

Embodiment 2

[0035] Example 2: Establishment and grouping of animal models

[0036] According to the inoculum size of 1:10, inoculate the logarithmic growth of Streptococcus salivarius in sterilized BHI medium, culture overnight at 37°C, centrifuge at 3000G / min for 10min, discard the supernatant, and resuspend with PBS. Adjust to 10^7CFU / mL.

[0037] Male C57 / B6 mice, weighing 22-27g, 8 weeks old, were randomly divided into Control group and S.S group, with 10 mice in each group, and were raised in the SPF environment of a university experimental animal center. Animals were acclimatized for one week before dosing. Both groups were given 2.5% dextran sulfate (mpbio, 9011-18-1) free drinking water for 6 days. The Control group was given 0.2 mL / bird every day for 3 consecutive days; the S.S group was given 0.2 mL / bird of Streptococcus salivarius resuspended in PBS for 3 consecutive days. After overnight starvation, the mice were sacrificed by cervical dislocation, the intestinal length was...

Embodiment 3

[0038] Example 3: qPCR detection of intestinal inflammatory factors

[0039] Intestinal specimens preserved at -80° were taken, ground in liquid nitrogen, and total RNA was extracted using the TRIzol method, and cDNA was reverse-transcribed using TransScript Two-Step RT-PCR SuperMix (AT401).

[0040] Quantitative PCR amplification:

[0041] Amplification reaction system: Amplification system (20μL):

[0042] TransStart Green qPCR SuperMix 10 μL DNA template 2μL pre-primer 1μL back primer 1μL Ultra-pure water 6μL

[0043] Primer sequence:

[0044] mouse-TNF-a-F CCCTCACACTCAGATCATTCTTCT mouse-TNF-a-R GCTACGACGTGGGCTACAG mouse-IFN-g-F ATGAACGCTACACACTGCATC mouse-IFN-g-R CCATCCTTTTGCCAGTTCCTC mouse-GAPDH-F AGGTCGGTGTGAACGGATTTG mouse-GAPDH-R TGTAGACCATGTAGTTGAGGTCA

[0045] Amplification program: 95°15min; (95°30S, 60°30S)X40 cycle.

[0046] Data analysis and calculation: According t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides streptococcus salivarius and an application thereof to preparation of medicines for treatment of inflammatory bowel diseases, and relates to the field of a biological technology. The streptococcus salivarius (streptococcus salivarius) 1802 is preserved in the preservation center with the preservation number of CCTCC NO:M 2019251. A screening method of the streptococcus salivarius comprises the steps of enabling excrement of healthy people to be subjected to suspension with bacteria-free water, performing diluting until the volume is 10-6 times, and performing fractionalcultivation in a brain-heart leaching solution culture medium with a plate streak to obtain the streptococcus salivarius (streptococcus salivarius) 1802. The streptococcus salivarius (streptococcus salivarius) 1802 can be applied to preparation of medicines for treatment of inflammatory bowel diseases, can be used in medicines for relieving inflammatory reactions of the inflammatory bowel diseases, and can be applied to medicines for relieving inflammatory bowel disease colon mucous membrane injury.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a streptococcus salivarius and its application in medicine for treating inflammatory bowel disease. Background technique [0002] Inflammatory bowel disease (Inflammation Bowel Disease, IBD) is a collective term for a group of idiopathic intestinal chronic diseases, which can be divided into ulcerative colitis (Ulcerativecolitis, UC) and Crohn's disease (Crohn's disease, CD) ). Ulcerative colitis usually first manifests as continuous inflammation involving the rectal mucosa and submucosa, and gradually spreads to the entire colon, while Crohn's disease often involves discontinuous full-thickness inflammation of the ileocecal intestine. The main symptoms of inflammatory bowel disease are abdominal pain, vomiting, tenesmus, bloody stool and other abdominal symptoms, as well as systemic symptoms such as anemia, fever and malnutrition. As the disease progresses, the risk of colorectal c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N1/02A61K35/744A61P1/00A61P29/00C12R1/46
CPCA61K35/744A61P1/00A61P29/00C12N1/02C12N1/20C12N1/205C12R2001/46
Inventor任建林吴景烔张翔陈章然许鸿志
OwnerXIAMEN UNIV