Vigor repair peptide Tvigour A and application thereof
A peptide and DNA sequence technology, applied in the field of biomedicine, can solve problems such as low transdermal absorption efficiency, and achieve the effect of reducing skin damage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Preparation of Vitality Restoration Peptide Tvigour A
[0064] The preparation method of the vitality repairing peptide Tvigour A (the amino acid sequence is shown in SEQ ID NO: 1), comprising the following steps:
[0065] (1) Cloning the DNA fragment encoding the vitality repair peptide Tvigour A (the nucleotide sequence shown in SEQ ID NO: 2, the DNA fragment was synthesized by Shanghai Jierui Bioengineering Co., Ltd.) into the prokaryotic expression vector pET3c, newly constructed and Recombinant expression plasmid pET3c-Tvigour A;
[0066] The primers for molecular cloning are as follows:
[0067] Upstream primer: AAGATGAAGGGTAGAAA, as shown in SEQ ID NO: 5;
[0068] Downstream primer: TTGCAAACCTGGAGCTCC, as shown in SEQ ID NO:6.
[0069] (2) Transform the constructed plasmid into Escherichia coli BL21 (DE3), and the ampicillin antibiotic selection method is preferred for recombinants;
[0070] (3) IPTG (1mmol / L) induces expression, optimizes fermentation condit...
Embodiment 2
[0073] Preparation of Vitality Restoration Peptide Tvigour A
[0074] The preparation method of the activity restoration peptide Tvigour A (the amino acid sequence is shown in SEQ ID NO: 3) comprises the following steps:
[0075] (1) Cloning the DNA fragment encoding the vitality repair peptide Tvigour A (the nucleotide sequence shown in SEQ ID NO: 4, the DNA fragment was synthesized by Shanghai Jierui Bioengineering Co., Ltd.) into the prokaryotic expression vector pET3c, newly constructed and Recombinant expression plasmid pET3c-Tvigour A;
[0076] The primers for molecular cloning are as follows:
[0077] Upstream primer: CATCATCATCATCATCATCATAAGATG, as shown in SEQ ID NO: 7;
[0078] Downstream primer: TTGCAAACCTGGAGCTCC, as shown in SEQ ID NO:6.
[0079] (2) Transform the constructed plasmid into Escherichia coli BL21 (DE3), and the ampicillin antibiotic selection method is preferred for recombinants;
[0080] (3) IPTG (1mmol / L) induces expression, optimizes fermentat...
Embodiment 3
[0083] Preparation of lyophilized powder containing vitality repairing peptide Tvigour A
[0084] 1) The liquid composition of the freeze-dried powder containing vitality repairing peptide Tvigour A before freeze-drying
[0085] In the liquid before freeze-drying of the lyophilized powder of vitality repairing peptide Tvigour A, the mass percentage of each component is as follows:
[0086]
[0087] 2) The preparation method of the lyophilized powder containing vitality repairing peptide Tvigour A
[0088] Step 1: Dissolve hyaluronic acid in water, swell overnight at room temperature, then autoclave (121°C, 20min), and cool to room temperature to obtain solution A;
[0089] Step 2: dissolving soluble collagen in water, then adding proteoglycan and Tvigour A to it to obtain solution B;
[0090] Step 3: filter and sterilize solution B to obtain solution C;
[0091] Step 4: Under sterile conditions, mix the sterilized A and C solutions, first pre-freeze at -20°C for 5 hours,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


