Vigor repair peptide Tvigour A and application thereof

A peptide and DNA sequence technology, applied in the field of biomedicine, can solve problems such as low transdermal absorption efficiency, and achieve the effect of reducing skin damage

Active Publication Date: 2019-12-03
BIOPHARM RES & DEV CENT JINAN +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to overcome the shortcomings and deficiencies of the prior art, the present invention provides a kind of active peptide Tvigour A, which has the ability to inhibit the proliferation of scar cells, and can promote the proliferation of skin fibroblasts at the same time, thereby possessing tissue repair function; and other molecules (especially Macromolecular polypeptides and protein molecules) can increase the transdermal absorption rate of other molecules when used in combination, thereby effectively solving the problem of low transdermal absorption efficiency of polypeptide active molecules and drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vigor repair peptide Tvigour A and application thereof
  • Vigor repair peptide Tvigour A and application thereof
  • Vigor repair peptide Tvigour A and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Preparation of Vitality Restoration Peptide Tvigour A

[0064] The preparation method of the vitality repairing peptide Tvigour A (the amino acid sequence is shown in SEQ ID NO: 1), comprising the following steps:

[0065] (1) Cloning the DNA fragment encoding the vitality repair peptide Tvigour A (the nucleotide sequence shown in SEQ ID NO: 2, the DNA fragment was synthesized by Shanghai Jierui Bioengineering Co., Ltd.) into the prokaryotic expression vector pET3c, newly constructed and Recombinant expression plasmid pET3c-Tvigour A;

[0066] The primers for molecular cloning are as follows:

[0067] Upstream primer: AAGATGAAGGGTAGAAA, as shown in SEQ ID NO: 5;

[0068] Downstream primer: TTGCAAACCTGGAGCTCC, as shown in SEQ ID NO:6.

[0069] (2) Transform the constructed plasmid into Escherichia coli BL21 (DE3), and the ampicillin antibiotic selection method is preferred for recombinants;

[0070] (3) IPTG (1mmol / L) induces expression, optimizes fermentation condit...

Embodiment 2

[0073] Preparation of Vitality Restoration Peptide Tvigour A

[0074] The preparation method of the activity restoration peptide Tvigour A (the amino acid sequence is shown in SEQ ID NO: 3) comprises the following steps:

[0075] (1) Cloning the DNA fragment encoding the vitality repair peptide Tvigour A (the nucleotide sequence shown in SEQ ID NO: 4, the DNA fragment was synthesized by Shanghai Jierui Bioengineering Co., Ltd.) into the prokaryotic expression vector pET3c, newly constructed and Recombinant expression plasmid pET3c-Tvigour A;

[0076] The primers for molecular cloning are as follows:

[0077] Upstream primer: CATCATCATCATCATCATCATAAGATG, as shown in SEQ ID NO: 7;

[0078] Downstream primer: TTGCAAACCTGGAGCTCC, as shown in SEQ ID NO:6.

[0079] (2) Transform the constructed plasmid into Escherichia coli BL21 (DE3), and the ampicillin antibiotic selection method is preferred for recombinants;

[0080] (3) IPTG (1mmol / L) induces expression, optimizes fermentat...

Embodiment 3

[0083] Preparation of lyophilized powder containing vitality repairing peptide Tvigour A

[0084] 1) The liquid composition of the freeze-dried powder containing vitality repairing peptide Tvigour A before freeze-drying

[0085] In the liquid before freeze-drying of the lyophilized powder of vitality repairing peptide Tvigour A, the mass percentage of each component is as follows:

[0086]

[0087] 2) The preparation method of the lyophilized powder containing vitality repairing peptide Tvigour A

[0088] Step 1: Dissolve hyaluronic acid in water, swell overnight at room temperature, then autoclave (121°C, 20min), and cool to room temperature to obtain solution A;

[0089] Step 2: dissolving soluble collagen in water, then adding proteoglycan and Tvigour A to it to obtain solution B;

[0090] Step 3: filter and sterilize solution B to obtain solution C;

[0091] Step 4: Under sterile conditions, mix the sterilized A and C solutions, first pre-freeze at -20°C for 5 hours,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a vigor repair peptide Tvigour A and application thereof in preparation of skin external products, especially products for regenerating and repairing skin tissue injury. The vigor peptide Tvigour A has the capacity of inhibiting reproduction of scar cells and promoting reproduction of skin fibroblast and has a tissue repairing function. When the vigor repair peptide Tvigour A is combined with other molecules (especially macromolecular polypeptides, protein molecules), the transdermal absorption ratio of other molecules can be improved, and the problem of low transdermal absorption efficiency of polypeptide active molecules and medicines can be effectively solved.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a vitality repairing peptide Tvigour A and its application in the preparation of external skin products, especially products for regeneration and repair of skin tissue damage. Background technique [0002] Human skin is the organ most directly in contact with the outside world, and is the first physiological barrier of the human immune system. To a certain extent, it can prevent external unfavorable factors (physical, chemical, biological, etc.) from entering the human body and causing damage to the body. At the same time, it has the functions of moisturizing, anti-inflammatory and skin regulation, so as to maintain the stability of its skin barrier function. Maintaining the normal barrier function of the skin is the foundation and an important part of skin care. Hormone level fluctuations, mental stress, external stimuli, ultraviolet rays, environmental pollution, imprope...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/00C12N15/11C07K19/00A61K38/17A61P17/02A61K8/64A61Q19/00A61Q19/08A61Q19/02
CPCC07K14/00A61P17/02A61K8/64A61Q19/00A61Q19/08A61Q19/02C07K2319/21A61K38/00
Inventor 项琪黄亚东薛来武
Owner BIOPHARM RES & DEV CENT JINAN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap