Preparation method of adeno-associated virus with epigenetic modification function and application thereof
A viral vector and DNA virus technology, applied in the biological field, can solve the problems of incompletely clear expression regulation mechanism and no stress-induced cognitive impairment, and achieve the improvement of new object recognition ability, learning and memory ability, and host range. wide effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1, Construction and Identification of Eukaryotic Expression Vector Containing TET1 Enzyme Catalytic Activity Domain
[0037] 1.1 Target gene cloning and purification
[0038] (1) CDS region sequence of Tet1 mRNA (NM_030625.3)
[0039] >NM_030625.3:529-6939Homo sapiens tet methylcytosine dioxygenase 1 (TET1), mRNA, the specific sequence is shown in SEQ ID NO: 1, where the underline is the position of the PCR primer.
[0040] (2) Design and synthesize primers for cloning.
[0041] The full-length Tet1 gene cannot be completely cloned into the gland-associated expression vector due to its long length. Therefore, primers were designed to obtain the gene encoding the catalytic activity domain of Tet1 enzyme by PCR, and then cloned into the gland-associated expression vector. The primer sequences used for cloning are as follows:
[0042] SEQ ID NO: 3TET1-Forward primer:
[0043] GGAGGTAGTGGAAT GGATCC CGCCACCATGGAACTGCCCACCTGCAGCTGTC;
[0044] SEQ ID NO:4TET1-Reve...
Embodiment 2
[0080] Embodiment 2, recombinant plasmid expression detection
[0081] 2.1 Cell transfection
[0082] (1) Take 293T cells in the logarithmic growth phase, seed them into 6-well culture plates at a density of 50%, and place them in 5% CO 2 , Cultivate in a 37°C incubator until the cell density reaches about 80%.
[0083] (2) According to the instruction manual of lipofectamine 2000 transfection reagent (Invitrogen Company), the mixture of plasmid and transfection reagent was prepared and added to the cells dropwise.
[0084] (3) Observe the state of the cells after 4-6 hours, and replace with fresh complete medium. After 24-48 hours of transfection, the fluorescence expression of the cells was observed under a fluorescence microscope and photographed ( Figure 5 ).
[0085] 2.2 Extraction of total cell protein
[0086] (1) After the above cells are overgrown, discard the medium, wash twice with PBS, add 100 μL of RIPA lysate containing protease inhibitors (Beiyuntian Compa...
Embodiment 3
[0102] Embodiment 3, packaging adeno-associated virus
[0103] 3.1 Culture of AAV-293 cells
[0104] (1) Recovery of AAV-293 cells
[0105] a. Configure DMEM medium (called complete medium) containing 10% FBS for the cultivation of AAV-293 cells.
[0106] b. Add 3mL of complete medium into a 10mL glass centrifuge tube.
[0107] c. Take the cells out of the liquid nitrogen tank or -80°C refrigerator, quickly put them in a 37°C water bath, and shake them gently for 1-2 minutes to completely melt them.
[0108] d. Take the cryotube to the ultra-clean bench and wipe the surface with an alcohol cotton ball for disinfection. Add the cell suspension to the centrifuge tube prepared in advance.
[0109] e. Centrifuge at 800g×3min, discard the supernatant, add 2mL of new complete medium, blow gently with a dropper to suspend the cells, inoculate into a 10cm culture dish containing 8mL of fresh complete medium, and place at 37°C, 5% CO 2 cultured in an incubator.
[0110] 3.2 Passag...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


