Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of adeno-associated virus with epigenetic modification function and application thereof

A viral vector and DNA virus technology, applied in the biological field, can solve the problems of incompletely clear expression regulation mechanism and no stress-induced cognitive impairment, and achieve the improvement of new object recognition ability, learning and memory ability, and host range. wide effect

Inactive Publication Date: 2020-03-06
ACADEMY OF MILITARY MEDICAL SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the expression regulation mechanism of neurotrophic factors is still not completely clear, there has been no report on the treatment of stress-induced cognitive impairment by regulating its expression through epigenetic modification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of adeno-associated virus with epigenetic modification function and application thereof
  • Preparation method of adeno-associated virus with epigenetic modification function and application thereof
  • Preparation method of adeno-associated virus with epigenetic modification function and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1, Construction and Identification of Eukaryotic Expression Vector Containing TET1 Enzyme Catalytic Activity Domain

[0037] 1.1 Target gene cloning and purification

[0038] (1) CDS region sequence of Tet1 mRNA (NM_030625.3)

[0039] >NM_030625.3:529-6939Homo sapiens tet methylcytosine dioxygenase 1 (TET1), mRNA, the specific sequence is shown in SEQ ID NO: 1, where the underline is the position of the PCR primer.

[0040] (2) Design and synthesize primers for cloning.

[0041] The full-length Tet1 gene cannot be completely cloned into the gland-associated expression vector due to its long length. Therefore, primers were designed to obtain the gene encoding the catalytic activity domain of Tet1 enzyme by PCR, and then cloned into the gland-associated expression vector. The primer sequences used for cloning are as follows:

[0042] SEQ ID NO: 3TET1-Forward primer:

[0043] GGAGGTAGTGGAAT GGATCC CGCCACCATGGAACTGCCCACCTGCAGCTGTC;

[0044] SEQ ID NO:4TET1-Reve...

Embodiment 2

[0080] Embodiment 2, recombinant plasmid expression detection

[0081] 2.1 Cell transfection

[0082] (1) Take 293T cells in the logarithmic growth phase, seed them into 6-well culture plates at a density of 50%, and place them in 5% CO 2 , Cultivate in a 37°C incubator until the cell density reaches about 80%.

[0083] (2) According to the instruction manual of lipofectamine 2000 transfection reagent (Invitrogen Company), the mixture of plasmid and transfection reagent was prepared and added to the cells dropwise.

[0084] (3) Observe the state of the cells after 4-6 hours, and replace with fresh complete medium. After 24-48 hours of transfection, the fluorescence expression of the cells was observed under a fluorescence microscope and photographed ( Figure 5 ).

[0085] 2.2 Extraction of total cell protein

[0086] (1) After the above cells are overgrown, discard the medium, wash twice with PBS, add 100 μL of RIPA lysate containing protease inhibitors (Beiyuntian Compa...

Embodiment 3

[0102] Embodiment 3, packaging adeno-associated virus

[0103] 3.1 Culture of AAV-293 cells

[0104] (1) Recovery of AAV-293 cells

[0105] a. Configure DMEM medium (called complete medium) containing 10% FBS for the cultivation of AAV-293 cells.

[0106] b. Add 3mL of complete medium into a 10mL glass centrifuge tube.

[0107] c. Take the cells out of the liquid nitrogen tank or -80°C refrigerator, quickly put them in a 37°C water bath, and shake them gently for 1-2 minutes to completely melt them.

[0108] d. Take the cryotube to the ultra-clean bench and wipe the surface with an alcohol cotton ball for disinfection. Add the cell suspension to the centrifuge tube prepared in advance.

[0109] e. Centrifuge at 800g×3min, discard the supernatant, add 2mL of new complete medium, blow gently with a dropper to suspend the cells, inoculate into a 10cm culture dish containing 8mL of fresh complete medium, and place at 37°C, 5% CO 2 cultured in an incubator.

[0110] 3.2 Passag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of a recombinant single-stranded DNA virus vector with a heterologous nucleic acid sequence in preparation of a medicine for treating stress cognitive impairment, which comprises a pharmaceutical composition comprising the virus vector, a method for preparing the virus vector, and an application of the virus vector in research on an epigenetic regulation mechanism and treatment on cognitive disorder caused by stress. Wherein the recombinant single-stranded DNA virus vector is an adeno-associated virus vector, and the heterologous nucleic acid encodes therapeutic protein; wherein the therapeutic protein is TET1 (1418 to 2136aa). The adeno-associated virus with the epigenetic modification function is artificially prepared, expression of neurotrophic factors such as BDNF can be induced through epigenetic modification after the adeno-associated virus infects an organism, neuron survival and neurogenesis are maintained, dendritic spine maturation is promoted, and therefore the effect of resisting and treating stress cognitive injuries is achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a preparation method of an adeno-associated virus with epigenetic modification function and its application in stress cognitive injury. Background technique [0002] With the acceleration of the pace of life in modern society and the intensification of social competition, most people are under varying degrees of stress load, manifested as overactivation of the sympathetic nervous system and hyperfunction of the HPA axis. Epidemiological surveys have shown that the prevalence of mild cognitive impairment and dementia in people who have been in a state of stress for a long time is more than twice that of non-stressed people of the same age. Among patients with diagnosed cognitive impairment, more than 70% are accompanied by dysfunction of the HPA axis. High levels of stress hormones can lead to structural and functional changes in multiple brain regions, including reduced ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/864C12N15/57A61K48/00A61K38/48A61P25/28
CPCA61K38/4813A61K48/005A61P25/28C12N15/86C12N2750/14143C12N2800/107C12Y304/11
Inventor 谢方王雪钱令嘉王世达赵云
Owner ACADEMY OF MILITARY MEDICAL SCI