Chitosanase mutant and application thereof

A chitosanase and mutant technology, applied in the field of genetic engineering, can solve the problems of enzyme thermal stability, low enzyme activity, and restriction of large-scale industrial development of enzymatic degradation of chitosan, so as to improve enzyme activity And its thermal stability, chitosan enzyme activity is high, the effect of excellent thermal stability

Active Publication Date: 2020-04-21
潍坊麦卡阿吉生物科技有限公司
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Enzymatic degradation of chitosan has many advantages, but there are still some aspects to be improved in this method. The first aspect is that the enzymatic activity of chitosanase is generally low; the second aspect is that the thermal stability of the enzyme needs to be improved.
These two aspects restrict the development of enzymatic degradation of chitosan to large-scale industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chitosanase mutant and application thereof
  • Chitosanase mutant and application thereof
  • Chitosanase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] (1) Acquisition of chitosanase gene

[0029] According to the gene sequence of chitosanase BC345 in the genome DNA of human intestinal bacteria Bacteroides clarus YIT 12056 strain (reviewed by GenBank: AFBM00000000.1), codon optimization and gene synthesis were carried out.

[0030] The gene sequence of chitosanase BC345 is shown in SEQ ID NO: 1; the sequence after optimizing the original sequence was completed by Huada Qinglan Biotechnology (Wuxi) Co., Ltd., and the sequence after codon optimization is shown in SEQ ID NO: 2 Shown, the amino acid sequence of this chitosanase gene code is shown in SEQ ID NO:3:

[0031] SEQ ID NO:1:

[0032] ATGAAAACATGGAAAGCAGAAGCCGCCATTATTGCTGTCGGTATGGTTTTGTTGGGAGTGGTAATAAAATGGGGTATAAACGATTTTATAGATAAGGAGCGTATTGTCAGCGTAAAAGGGCTGGCTGAGATGGAAGTCCCCGCCGATAAGGTAATATGGCCTTTGATGTATAAGGATATCGGGAACGACCCGTCTTTGCTTTATGCCAATATGGAGCAGAAGAACAAAGTTATTGTAAAGTTTCTGGAAAGTAACGGCATCGCTAAAGAAGAAATCAGCATTGCTCCGCCCGAAGTGATAGACATGCAGGCCGAACGTTACGGAAACCGTGATAT...

Embodiment 2

[0088] The determination of embodiment 2 chitosanase BC345 enzymatic properties

[0089] ① The molecular weight of the chitosanase is determined: the purified BC345 protein sample is subjected to discontinuous sodium dodecylsulfonate-polyacrylamide SDS-PAGE gel electrophoresis in a conventional manner, and the results are as follows: figure 2 shown. It is detected as an electrophoresis band by denaturing polyacrylamide gel electrophoresis, and compared with standard protein SDS-PAGE electrophoresis patterns of known molecular weight, the molecular weight of BC345 protein is about 26000 Daltons (26kDa), and the enzyme is a monomeric protein.

[0090] ② Determination of chitosanase activity:

[0091] The activity of chitosanase was determined by dinitrosalicylic acid (DNS) method. Definition of enzyme activity unit: 1U means the amount of enzyme required to release 1 μmol of reducing sugar per minute under the above conditions. In order to measure the Km and Vmax of chitosan...

Embodiment 3

[0100] Construction of chitosanase mutants

[0101] 1) Mutant BC345 / Y116A mutates tyrosine Y at position 116 of the amino acid sequence of chitosanase BC345 to alanine A, as shown in SEQ ID NO: 4 below. The specific implementation method is that the plasmid pPICAɑ-BC345 obtained in the above example is used as a template through the primers of site-directed mutagenesis, and the mutant primers are as follows, and the mutant strain is obtained by PCR.

[0102] The PCR reaction system is as follows:

[0103] Forward primer (10pM) 1μL Reverse primer (10pM) 1μL template DNA 1μL 2×TransStart FastPfu PCR SuperMix 50μL H 2 O

43μL

[0104] PCR amplification conditions were as follows: pre-denaturation, denaturation, annealing, extension, 33 cycles, extension. Length: 27 Upstream primers:

[0105] 5'-AGAGCCAACGCTACTTCTGTTATCACT-3'

[0106] Length: 29

[0107] Downstream primers:

[0108] 5'-AGCGTTGGCTCTGTAAGCGATGTCTCTGT-3'

[0109] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to genetic engineering modification, in particular to a chitosanase mutant and an application thereof. The chitosanase mutant is obtained by mutating tyrosine Y at the 116th siteof an amino acid sequence of chitosanase BC345 into alanine A. A section of amino acid rich in alanine A is added to the tail end of amino acid of the chitosanase BC345 mutant, or tyrosine Y at the 116th site of the amino acid sequence of the chitosanase BC345 mutant is mutated into alanine A, and a section of amino acid rich in alanine A is added to the tail end of amino acid of the chitosanaseBC345 mutant. The chitosanase mutant used in the invention is high in activity and resistant to high temperature. The chitosanase is reasonably modified, and the enzyme activity and the thermal stability of the chitosanase are greatly improved through site-specific mutagenesis and increase of flexible fragments, so that the chitosanase has the potential of industrial production of chitosan oligosaccharide.

Description

technical field [0001] The invention relates to genetic engineering transformation, in particular to a chitosanase mutant and its application. Background technique [0002] Chitosan is the product of deacetylation of chitin. It is the only alkaline polysaccharide existing in nature. It is biodegradable, non-toxic to animals, soluble in acidic solutions, available in various physical forms and easier to handle Features. Chitosan is used in many fields, but generally the molecular weight of chitosan produced is very large, and macromolecular chitosan is insoluble in water and cannot play some special functions of chitosan oligosaccharides. Therefore, chitosan needs It is further degraded into chitosan oligosaccharides by chemical or enzymatic methods. Chitosan oligosaccharide has the characteristics of good water solubility, non-toxicity, compatibility with organisms, environmental friendliness, and easy degradation by organisms. It is currently widely used in medicine and h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/24C12N15/81C12N1/19C12P19/00C12P19/04C12P19/12C12P19/14C12R1/84
CPCC12N9/2402C12N15/815C12P19/00C12P19/04C12P19/12C12P19/14C12Y302/01132
Inventor公衍军石琨
Owner潍坊麦卡阿吉生物科技有限公司