Human recombinant interferon fusion gene obtained based on gene modification, fusion protein and preparation method thereof
A technology of fusion protein and fusion gene, which is applied to the preparation method of peptides, methods based on microorganisms, cytokines/lymphokines/interferons, etc., and can solve the problems of no biological activity, affecting production efficiency and production cost, and renaturation. Problems such as difficulty in purification and purification, to achieve the effect of simplified purification steps and high purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0041] Example 1
[0042] The histidine tag and the glutamic acid lysine repeat unit were introduced into the original human recombinant interferon IFN-β1b (GenScript Biotech Corporation) gene sequence by PCR amplification to obtain a recombinant human interferon IFN-β based on genetic modification The nucleotide sequence of the fusion protein is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.
[0043] The PCR amplification reaction system is as follows: first, 2.5 μL of the gene sequence SEQ ID NO. 3 of 50 repeating KE amino acid units is used as the template DNA, 0.5 μL of the gene sequence SEQ ID NO. 4: CATATGGAAAACCTGTATTT as the upstream primer, and 0.5 μL of the gene sequence of SEQ ID NO .5: CTTTTTCTTAAG CTACTA CTATTT is used as the downstream primer, and distilled water is made up to 50μL. The reaction process is as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 1 min, annealing at 5°C for 30s, extension at 72°C for 40s,...
Example Embodiment
[0044] Example 2
[0045] The IFN-KE50 fusion gene and 2 μg PET-28a(+) plasmid (Solarbio|Cat. No.: P3110) obtained in Example 1 were digested with restriction enzymes NdeI and NotI, respectively. The reaction system is: 1.5μL Nde Ⅰ enzyme, 1.5μL Not Ⅰ enzyme, 5μL 10×Buffer, 2-5μg pET-28a(+) plasmid or IFN-KE50 fusion gene, ddH 2 Make up to 50μL of O and bath at 37°C for 30min. The digested IFN-KE50 fusion gene and pET-28a(+) plasmid were recovered from agarose gel, and the IFN-KE50 fusion plasmid was obtained by ligating at 16°C for 4hrs with T4 ligase, and then the IFN-KE50 fusion plasmid was transfected Into the competent cells of E. coli (BL21(DE3)), spread on an LB plate containing 50μg / mL kanamycin, and invert the culture overnight at 37°C. Pick colonies on the plate and place them in 50 mL of kanamycin-containing LB liquid medium, with a kanamycin concentration of 50 μg / mL, and culture at 37°C for 12 hours to expand the culture to obtain the transfected IFN-KE50 fusion pla...
Example Embodiment
[0046] Example 3
[0047] Take 3 mL of E. coli transfected with IFN-KE50 fusion gene in a volume ratio of 1 to 100 in 300 mL of 2×YT medium, add kanamycin to a concentration of 50 μg / mL, and place it at 37°C After culturing for 2.5 hours, add the IPTG inducer to make the concentration in the culture medium 0.1mM / L. After culturing and expressing for 12 hours at a temperature of 16°C, an E. coli broth containing IFN-KE50 fusion protein is obtained.
[0048] After adding the IPTG inducer according to the above steps, culture and express at 37°C for 12h, and the rest of the steps remain unchanged to obtain the E. coli strain containing the IFN-KE50 fusion protein induced at 37°C.
[0049] The SDS-PAGE electrophoresis of the IFN-KE50 fusion protein is as figure 1 As shown, the expression under two different temperature conditions was investigated, among which 1 is Marker; 2 is 16℃IFN-KE50 supernatant; 3 is 16℃IFN-KE50 precipitation; 4 is 37℃IFN-KE50 supernatant ; 5 is 37°C IFN-KE50 prec...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2023 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap