Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human recombinant interferon fusion gene obtained based on gene modification, fusion protein and preparation method thereof

A technology of fusion protein and fusion gene, which is applied to the preparation method of peptides, methods based on microorganisms, cytokines/lymphokines/interferons, etc., and can solve the problems of no biological activity, affecting production efficiency and production cost, and renaturation. Problems such as difficulty in purification and purification, to achieve the effect of simplified purification steps and high purity

Inactive Publication Date: 2020-05-19
DALIAN UNIV OF TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The target protein usually has no biological activity after being expressed as inclusion body, and its renaturation and purification are very difficult
At present, the expression of interferon through the E. coli system is the expression of inclusion bodies, which seriously affects its production efficiency and production cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human recombinant interferon fusion gene obtained based on gene modification, fusion protein and preparation method thereof
  • Human recombinant interferon fusion gene obtained based on gene modification, fusion protein and preparation method thereof
  • Human recombinant interferon fusion gene obtained based on gene modification, fusion protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042]A histidine tag and glutamic acid-lysine repeating unit were introduced into the gene sequence of the original human recombinant interferon IFN-β1b (GenScript Biotech Corporation) by PCR amplification, and a human recombinant interferon IFN-β based on genetic modification was obtained. A fusion protein, the nucleotide sequence of the fusion protein is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0043] The PCR amplification reaction system is as follows: first, 2.5 μL of the gene sequence SEQ ID NO.3 with 50 repeated KE amino acid units is used as template DNA, 0.5 μL of the gene sequence of SEQ ID NO.4: CATATGGAAAACCTGTATTT as the upstream primer, and 0.5 μL of the gene sequence of SEQ ID NO. .5: CTTTTTCTTAAG CTACTA CTATTT was used as a downstream primer and made up to 50 μL with distilled water. The reaction process is as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 1 min, annealing at 5°C for 30 s, extension a...

Embodiment 2

[0045] The IFN-KE50 fusion gene obtained in Example 1 and 2 μg of the PET-28a(+) plasmid (Solarbio | product number: P3110) were digested with restriction endonucleases NdeI and NotI, respectively. The reaction system is: 1.5 μL Nde Ⅰ enzyme, 1.5 μL Not Ⅰ enzyme, 5 μL 10×Buffer, 2-5 μg pET-28a(+) plasmid or IFN-KE50 fusion gene, ddH 2 Make up to 50 μL with O, and bathe in water at 37°C for 30 minutes. The digested IFN-KE50 fusion gene and pET-28a(+) plasmid were recovered from the agarose gel, ligated with T4 ligase at 16°C for 4 hrs to obtain the IFN-KE50 fusion plasmid and placed at room temperature for 2 hrs, and the IFN-KE50 fusion plasmid was transfected To Escherichia coli competent cells (BL21(DE3)), spread on LB plates containing 50 μg / mL kanamycin, and culture overnight at 37°C upside down. Pick colonies on the plate and place them in 50 mL of LB liquid medium containing kanamycin, the concentration of kanamycin is 50 μg / mL, culture at 37°C for 12 hours and expand cu...

Embodiment 3

[0047] According to the volume ratio of 1 to 100, take 3 mL of Escherichia coli liquid transfected with the IFN-KE50 fusion gene in 300 mL of 2×YT medium, add kanamycin to make the concentration 50 μg / mL, and store at 37 ° C. 1. After culturing for 2.5 hours, add IPTG inducer to make the concentration in the culture medium 0.1mM / L, and culture and express at 16°C for 12 hours to obtain Escherichia coli liquid containing IFN-KE50 fusion protein.

[0048] After adding the IPTG inducer according to the above steps, culture and express at 37°C for 12 hours, and the rest of the steps remain unchanged to obtain the Escherichia coli liquid containing the IFN-KE50 fusion protein induced at 37°C.

[0049] The SDS-PAGE electrophoresis of described IFN-KE50 fusion protein is as follows figure 1 As shown, the expression under two different temperature conditions was investigated, among which 1 is Marker; 2 is 16 ℃ IFN-KE50 supernatant; 3 is 16 ℃ IFN-KE50 precipitation; 4 is 37 ℃ IFN-KE50 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human recombinant interferon fusion gene obtained based on gene modification, a fusion protein and a preparation method thereof, and belongs to the technical field of biological products. The gene of the human recombinant interferon IFN-beta is obtained based on gene modification, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1. The amino acid sequence ofthe fusion protein encoded by the gene is shown as SEQ ID NO. 2. The human recombinant interferon IFN-beta genetic sequence is amplified and connected with plasmid pET-28a (+) to obtain a fusion gene, and then the fusion gene is transfected into escherichia coli BL21 (DE3) to be amplified and expressed to obtain soluble fusion protein. The problem that soluble interferon cannot be obtained from escherichia coli is solved. The invention further provides a purification method for obtaining the high-purity IFN-KE50 protein from the stable cell line, due to the fact that the protein is provided with the histidine tag, the target protein can be effectively purified by conducting affinity chromatography through immobilized metallic nickel, and the purity of the purified protein can reach 94.8%.The subsequent purification steps are simplified, and higher purity can be obtained.

Description

technical field [0001] The invention belongs to the technical field of biological products, and in particular relates to a fusion gene, fusion protein and preparation method of human recombinant interferon based on gene modification. [0002] technical background [0003] Interferon is a kind of glycoprotein with multiple functions produced by inducers to stimulate reticuloendothelial cells, macrophages, lymphocytes, etc., and has genera specificity. They have broad-spectrum antiviral activity and immunomodulatory functions. According to the gene type, structural characteristics and functional role of interferon, as well as the type of receptor on the cell surface, interferon is currently divided into three types. Type I interferons include IFN-α, IFN-β, IFN-δ, IFN-ε, IFN-ω, IFN-κ, IFN-ζ and IFN-τ. Among them, IFN-α has more than 20 subtypes; IFN-β has only one subtype; type II interferon is IFN-γ; type III interferon is IFN-λ, which can be divided into IFN-λ1, IFN- λ2 and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N15/70C12N1/21C07K19/00C07K1/22C12R1/19
CPCC07K14/555C07K14/56C07K14/565C07K2319/00C07K2319/21C12N15/70
Inventor 何炜孙彬玉程昉李明洋董继程刘波
Owner DALIAN UNIV OF TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com