Micromolecular protein used for indicating calcium ions and application of micromolecular protein
A small molecule and protein technology, applied in calcium binding protein, animal/human protein, application, etc., can solve the problems of calcium imaging technology, such as limited field of view, single stable optical path, and inaccurate data, so as to save experiment cycle and small molecular weight , the effect of accurate data
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1 plasmid construction
[0032] GEM core nucleotide sequence;
[0033]ATGGGTGTAGTCGCACGAAGAGCTACACCCGGTGACGCACAAGCCAACTCAGGTAGAGCTCCCGCCCGGCCATTTCAGTCTTTTGTGTCAAACGGAGCCATGCTGATGAACAAGCAAATTGTGGCTGGGATAGTTGCAGGTCTGGTCAGCATGTCCTCCCACGCACAGCTCGGTCAACTCTTCCAGTCTGTTAAGGAACAGGTCACTCAGGCAGCAACCTCTCAGGTAAATCAAGGAGTAAGGTCCGCTACTGACGAAGCCGTGCAAGCAACATCTAGTCGGACCAGAAAGGCCATTAACAGTGTTAGGTCCCCCTCAAGCGCAGCAGCCGCTACTTCTACAAGCCCTTCTGCTGCCGAGGAGACTAATGACGCTACCCTGAGTGAGGCCCGCAAATAA
[0034] This DNA sequence is the core sequence after design and transformation. It has been verified that it can bind manganese ions in animals, and it will show a high signal under nuclear magnetic resonance imaging. The present invention uses this principle to replace the traditional calcium ion imaging protein. Fluorescent protein; since this DNA sequence is designed and modified, it needs to be artificially synthesized;
[0035] Generic calmodulin CaM and myosin light chain M13 DNA sequences ...
Embodiment 2
[0038] Embodiment 2 experimental detection
[0039] Intracerebral microinjection of virus:
[0040] The present invention selects the rat striatum brain region to verify (the striatum is relatively large, relatively uniform, and isotropic, and other brain regions can also be used as experimental brain regions); adult rats are treated with chlorine hydrate After anesthetized by intraperitoneal injection of aldehyde, the rats were fixed on the stereotaxic position in prone position, the scalp was cut midline and the periosteum was separated; according to the position of the striatal nucleus in the rat brain atlas (A / P 0.6, M / L 3.0, D / V 5.2) Use a cranial drill to make a small hole in the skull, slowly inject 2000nL of lentivirus into the striatal brain region with a 10 microliter microinjection needle, and the injection speed is 100nL / min. remove the needle;
[0041] After 5-6 weeks after virus injection, MRI (uMR790, Shanghai United Imaging Healthcare) scanning was carried o...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap