Check patentability & draft patents in minutes with Patsnap Eureka AI!

Micromolecular protein used for indicating calcium ions and application of micromolecular protein

A small molecule and protein technology, applied in calcium binding protein, animal/human protein, application, etc., can solve the problems of calcium imaging technology, such as limited field of view, single stable optical path, and inaccurate data, so as to save experiment cycle and small molecular weight , the effect of accurate data

Active Publication Date: 2020-06-05
SHENZHEN INST OF ADVANCED TECH
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005]First of all, the operation is very cumbersome. When combining calcium imaging with two-photon to observe the calcium activity in the brain of experimental animals, it is necessary to pre-process the experimental animals, such as grinding the animal’s skull, etc. To achieve better imaging results; secondly, the existing calcium imaging technology is limited by the field of view of the microscope and can only record a small area of ​​the brain
The normal operation of the nervous system is the cooperation of many different brain regions, so the study of these processes requires careful and comprehensive observation and analysis of the entire central nervous system and even the peripheral nervous system, which cannot be achieved with current calcium imaging techniques Third, since the current calcium imaging technology requires the use of a two-photon microscope, the optical path of the imaging is extremely stable and single, so researchers need to fix the experimental animals to image, and in this case the brain activity is the same as that of animals. The brain activity in the free state has great differences, and the data obtained are also inaccurate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Micromolecular protein used for indicating calcium ions and application of micromolecular protein
  • Micromolecular protein used for indicating calcium ions and application of micromolecular protein
  • Micromolecular protein used for indicating calcium ions and application of micromolecular protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 plasmid construction

[0032] GEM core nucleotide sequence;

[0033]ATGGGTGTAGTCGCACGAAGAGCTACACCCGGTGACGCACAAGCCAACTCAGGTAGAGCTCCCGCCCGGCCATTTCAGTCTTTTGTGTCAAACGGAGCCATGCTGATGAACAAGCAAATTGTGGCTGGGATAGTTGCAGGTCTGGTCAGCATGTCCTCCCACGCACAGCTCGGTCAACTCTTCCAGTCTGTTAAGGAACAGGTCACTCAGGCAGCAACCTCTCAGGTAAATCAAGGAGTAAGGTCCGCTACTGACGAAGCCGTGCAAGCAACATCTAGTCGGACCAGAAAGGCCATTAACAGTGTTAGGTCCCCCTCAAGCGCAGCAGCCGCTACTTCTACAAGCCCTTCTGCTGCCGAGGAGACTAATGACGCTACCCTGAGTGAGGCCCGCAAATAA

[0034] This DNA sequence is the core sequence after design and transformation. It has been verified that it can bind manganese ions in animals, and it will show a high signal under nuclear magnetic resonance imaging. The present invention uses this principle to replace the traditional calcium ion imaging protein. Fluorescent protein; since this DNA sequence is designed and modified, it needs to be artificially synthesized;

[0035] Generic calmodulin CaM and myosin light chain M13 DNA sequences ...

Embodiment 2

[0038] Embodiment 2 experimental detection

[0039] Intracerebral microinjection of virus:

[0040] The present invention selects the rat striatum brain region to verify (the striatum is relatively large, relatively uniform, and isotropic, and other brain regions can also be used as experimental brain regions); adult rats are treated with chlorine hydrate After anesthetized by intraperitoneal injection of aldehyde, the rats were fixed on the stereotaxic position in prone position, the scalp was cut midline and the periosteum was separated; according to the position of the striatal nucleus in the rat brain atlas (A / P 0.6, M / L 3.0, D / V 5.2) Use a cranial drill to make a small hole in the skull, slowly inject 2000nL of lentivirus into the striatal brain region with a 10 microliter microinjection needle, and the injection speed is 100nL / min. remove the needle;

[0041] After 5-6 weeks after virus injection, MRI (uMR790, Shanghai United Imaging Healthcare) scanning was carried o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides micromolecular protein used for indicating calcium ions and an application of the micromolecular protein. The amino acid sequence of the micromolecular protein is shown in SEQ ID NO.1. The gene encoded micromolecular protein is named as GEM and is blended with CaM (calmodulin) and myosin light-chain kinase M13, and numerous defects in existing calcium imaging technologies can be overcome. A new calcium imaging technology which takes the whole situation and the microscopic situation into consideration and can record activity in brains of experiment animals freely moving in the true sense can be obtained with the adoption of the micromolecular protein, and the micromolecular protein has broad application prospects and huge market value.

Description

technical field [0001] The invention relates to the field of biology, in particular to a small molecular protein for indicating calcium ions and its application. Background technique [0002] Calcium imaging refers to the method of using calcium ion indicator to detect the concentration of calcium ion in tissue cells. In biological organisms, calcium ions generate a variety of intracellular signals that exist in almost every type of cell and play an important role in many functions, such as the control of cardiomyocyte contraction. In the nervous system of mammals, calcium ions are an important class of intracellular signaling molecules in neurons. In the resting state, the intracellular calcium ion concentration of most neurons is about 50-100nM. When the neurons are excited, the intracellular calcium ion concentration can increase by 10-100 times. The increase of calcium ion concentration is important for neurotransmitters. The release process is essential. In general, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N7/01A61K49/14
CPCC07K14/4728C12N9/12C12N9/16C12N15/86C12N7/00C12Y207/11018C12Y301/05001A61K49/14C07K2319/00C12N2740/15043C12N2740/15021C12N15/867C12N15/62C07K19/00C12N15/00C07K14/00C12Q1/00C12N15/63
Inventor 李翔杨海洋钱政江
Owner SHENZHEN INST OF ADVANCED TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More