Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for modifying diatomite and immobilization of glucose isomerase containing cells

A technology of glucose isomerase and diatomite, which is applied in the direction of isomerase, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of high production cost of fructose syrup, achieve high-efficiency preparation, good stability, The effect of high recovery rate of enzyme activity

Active Publication Date: 2020-07-24
ZHEJIANG UNIV OF TECH
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In recent years, with the growing demand for HFCS, the vigorous development of the HFCS industry has been promoted. There are tens of millions of tons of HFCS produced in the world every year. There is a great demand for immobilized glucose isomerase preparations, and my country's immobilized The glucose isomerase preparation market has been monopolized by foreign companies, resulting in high fructose syrup production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for modifying diatomite and immobilization of glucose isomerase containing cells
  • Method for modifying diatomite and immobilization of glucose isomerase containing cells
  • Method for modifying diatomite and immobilization of glucose isomerase containing cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: Diatomaceous earth modification

[0035] Take an appropriate amount of natural diatomaceous earth and add it to 2 times the volume of 6M hydrochloric acid solution, react for 2 hours to remove some metal oxide impurities, wash with deionized water until neutral, and resuspend in H 2 SO 4 and HNO 3 mixed acid (H 2 SO 4 Concentration 72%, HNO3 Concentration 17%) (mixed acid dosage is 6mL / g diatomaceous earth), ultrasonic treatment at 40°C for 3h to increase the oxygen content on the surface of diatomite, cooled to room temperature, suction filtered and washed with deionized water until neutral. Add an equal volume of water to the oxidized diatomite to make a slurry, place it in a muffle furnace and roast at 500°C for 3 hours, then filter, dry, and sieve to obtain modified diatomite, which is stored dry for later use. The prepared modified diatomite has a particle size of 1.5-4nm and a specific surface area of ​​17.56m 2 / g, pore volume 0.092mL / g, pore d...

Embodiment 2

[0039] Example 2: Construction of recombinant Escherichia coli E.coli BL21(DE3) / pET-28b-TEGI and preparation and performance determination of wet cells

[0040] The specific method is as follows:

[0041] (1) Construction of recombinant bacteria: the GI gene TEGI (nucleotide sequence shown in SEQ ID NO.1) of Thermoanaerobacter ethanolicus was ligated with PGEM-T vector and introduced into E.coli JM109, TEGI / PGEM-T and plasmid pET28b(+)-Nit were double digested, ligated overnight with ligase, and the ligation product pET28b(+)-TEGI was introduced into host E.coli BL21(DE3) to obtain recombinant E. coli E. coli. coli BL21(DE3) / pET28b(+)-TEGI.

[0042] The sequence of SEQ ID NO.1 is as follows:

[0043] atggtagaatacttcaaaaacgttcctcaaatcaaatacgaaggccctaaatctaacaacccttacgctttcaaattctacaaccctgatgaaatcatcgatggcaaacctcttaaagaacatcttcgtttctctgttgcttactggcatacattcacagctaacggcacagatcctttcggcgctcctacaatgcaacgtccttgggatcatttcacagatcctatggatatcgctaaagctcgtgttgaagctgctttcgaacttttcgaaaaactt...

Embodiment 3

[0048] Example 3: Enzyme immobilization

[0049] Prepare Na at pH 6.5 with distilled water 2 HPO 4 / NaH 2 PO 4 Buffer (50mM), take by weighing the glucose isomerase genetically engineered bacterium wet cell that 1g embodiment 1 method prepares and join the Na of 20mL pH6.5 2 HPO 4 / NaH 2 PO 4 Buffer (50mM), stirred thoroughly to obtain 20mL bacterial suspension. Accurately weigh 0.2g of natural diatomite and modified diatomite and add them to 20mL of bacterial suspension for mixing. At room temperature (25°C) and 650rpm, stir and adsorb in a water bath for 30min; then add 1mL of 5% polyethylene Aqueous imine solution (added by 5% of the total volume of the system), at room temperature, under the condition of 650rpm, stirred and cross-linked in a water bath for 1h, then added 1mL mass concentration of 10% glutaraldehyde aqueous solution (added by 0.5% of the total volume of the system), in At room temperature, under the condition of 650rpm, stir and crosslink in a water...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
specific surface areaaaaaaaaaaa
pore sizeaaaaaaaaaa
Login to View More

Abstract

The invention relates to a method for modifying diatomite and immobilization of glucose isomerase containing cells. The method comprises the steps of performing fermentation culture on genetically engineered bacteria containing glucose isomerase genes to obtain wet cell masses, and performing suspension with a buffer solution to prepare bacterial suspension; and adding the modified diatomite to the bacterial suspension, performing uniform stirring and mixing, adding polyethyleneimine, then adding glutaraldehyde, performing cross-linking, performing stirring at 15-35 DEG C for cross-linking for0.5-5h, then performing sucking filtration, washing filtration cakes with distilled water, and then performing crushing into granules so as to obtain an immobilization glucose isomerase preparation containing glucose isomerase. The immobilization method provided by the invention has the advantages of being low in cost of immobilization materials, simple to operate, and high in mechanical strength, prepared immobilization recombinant escherichia coli whole cells generating the glucose isomerase are used for catalyzing D-glucose to generate D-levulose, and under the condition of 60 DEG C, a reaction in batches is performed, and after 40 batches are reused, 86% or above of enzyme activity also exits. Through a continuous reaction for 603h, the time and space yield is 3.8kg / L / d, the average conversion rate is greater than 42%, and the method has favorable industrial application prospects.

Description

[0001] (1) Technical field [0002] The invention relates to a method for immobilizing cells containing glucose isomerase with modified diatomite. [0003] (2) Background technology [0004] Glucose isomerase (Glucose isomerase, GI), also known as xylose isomerase, can convert D-glucose into D-fructose with higher sweetness than sucrose. High Fructose Corn Syrup, the key enzyme of HFCS). HFCS is a kind of mixed sugar syrup composed of D-glucose and D-fructose processed by liquefaction, saccharification and continuous isomerization with corn starch as raw material. As a natural sweetener, fructose syrup has the advantages of high solubility, good chemical and thermal stability, high osmotic pressure, strong moisture absorption and moisture retention, and does not affect the flavor of food when mixed with other additives. It is widely used in food and soft drinks , pharmaceutical and other industries. [0005] Glucose isomerase can show high isomerization performance under sui...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N11/14C12N9/92C12N1/20C12R1/19
CPCC12N11/14C12N9/92C12Y503/01018C12N1/20
Inventor 金利群柳志强陈贤筱贾东旭张晓健金怡婷万克柔李勉郑裕国
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com