Method for producing nicotinamide mononucleotide by utilizing recombinant bacillus subtilis
A technology of Bacillus subtilis and nicotinamide is applied in the field of recombinant Bacillus subtilis to produce nicotinamide mononucleotide, and can solve the problems of low product yield, failure to meet commercial production requirements, and high substrate cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] In this example, the nicotinamide phosphoribosyltransferase expression element composed of the overlapping promoter P43 promoter derived from Bacillus subtilis (Bacillus subtilis) and the nicotinamide phosphoribosyltransferase gene derived from Haemophilus ducreyi was cloned into the integrated Plasmid pMLK83.
[0025] 1. Construction of recombinant plasmid pMLK83-P43
[0026] According to the promoter P43 sequence annotated in Genbank, the upstream primer was designed as 5'attgctggacgcttatggac3' and the downstream primer as 5'cgggatccattcctctcttacctataat 3'. PCR reaction system 100ul: DNA template (Bacillus subtilis 1A751 total DNA) 1ul (about 20ng), 5×PrimeSTAR Buffer 20ul, 10pmol / ul dNTP 2ul, 10pmol / ul forward and reverse primers 2ul each, 2.5U / ul PrimeSTAR HS DNA polymerase 1ul, add ddH 2 0 to 100ul. PCR reaction program: 94°C for 5min; 30 cycles of 94°C for 30s, 60°C for 30s, 72°C for 1min; 72°C for 10min; store at 4°C. The PCR fragment and plasmid pMLK83 were ...
Embodiment 2
[0033] This example will be derived from the promoter of the maltose amylase gene amyM derived from Bacillus licheniformis (Baclicus lincheniformis) and the trehalose synthase expression element derived from the gene of nicotinamide phosphoribosyltransferase from Thermus ruber (Meiothermus ruber) into the integration plasmid pMLK83.
[0034] 1. Construction of recombinant plasmid pMLK83-amyM
[0035] According to the promoter amyM sequence annotated in Genbank, the upstream primer was designed as 5'cccaagcttctgtacacttgcgtcctcca 3' and the downstream primer as 5'cgggatcctctcctcccctttcaatgtg3'. PCR reaction system 100ul: DNA template (Bacillus licheniformis ATCC 14580 total DNA) 1ul (about 20ng), 5×PrimeSTAR Buffer 20ul, 10pmol / ul dNTP 2ul, 10pmol / ul forward and reverse primers 2ul each, 2.5U / ul PrimeSTAR HS DNA polymerase 1ul, add ddH 2 0 to 100ul. PCR reaction program: 94°C for 5min; 30 cycles of 94°C for 30s, 60°C for 30s, and 72°C for 30s; 72°C for 10min; store at 4°C. T...
Embodiment 3
[0042] Construction of Derivative Strains of Bacillus subtilis 168 Deleting Transketolase Gene
[0043] The following DNA fragments are artificially synthesized:
[0044]
[0045]
[0046] The synthesized fragment was cloned on the Puc57 plasmid and named Puc57-TST.
[0047] Digest the Puc57-TST plasmid with EcoR I / Pst I, gel-purify the 1.7kb fragment, transform Bacillus subtilis 1A751 with conventional transformation methods, and screen spectinomycin-resistant (60ug / ml) colonies. The homologous double crossover transformants were screened by PCR method to obtain the Bacillus subtilis 168 derivative strain with deletion of transketolase gene. The PCR method for screening homologous double crossover transformants is as follows:
[0048] The following primers were synthesized: DT1: 5'gacccagaaggcaatgatgt 3'; DT2: 5'cttcaagccccgtgtatttg3'; DTC: 5'caccatcaccgcaaatactg 3'. After the transformants were cultured overnight in LB medium, the total DNA was extracted, and then th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


