A kind of mutant heat-resistant and alkali-resistant xylanase for papermaking and its application

A technology of xylanase and xylan, which is applied in the field of genetic engineering, can solve problems such as shortening the process flow, and achieve the effects of reducing cost, reducing use, and reducing kappa value

Active Publication Date: 2022-01-18
SHANDONG UNIV
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the practical application of TfXyl10A, there are still problems to be solved; shortening the process flow and improving production efficiency urgently require the emergence of xylanase with higher activity
Enzyme genetic engineering is an important means to improve enzyme activity, however, there are no reports about TfXyl10A enhancing enzyme activity and related mutant genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of mutant heat-resistant and alkali-resistant xylanase for papermaking and its application
  • A kind of mutant heat-resistant and alkali-resistant xylanase for papermaking and its application
  • A kind of mutant heat-resistant and alkali-resistant xylanase for papermaking and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1, the mutation of xylanase TfXyl10A and the construction of recombinant vector

[0023] (1) Obtain the xylanase TfXyl10A gene from the NCBI database, connect the TfXyl10A gene and the plasmid blunt-e1 (pEASY blunt-e1) to obtain the blunt-e1-TfXyl10A plasmid, the nucleoside of the blunt-e1-TfXyl10A plasmid The acid sequence is shown in SEQ ID No.3. Using the above-mentioned recombinant plasmid as a template, design mutation primers for site-directed mutation. The primer sequences are as follows:

[0024] E51A-sense: AGATGAAGTGGGCGTCGCTGGAG;

[0025] E51A-antisense: CCAGCGACGCCCACTTCATCTCG;

[0026] The PCR amplification reaction system is as follows:

[0027]

[0028]

[0029] The reaction procedure is as follows:

[0030] Preheating, 94°C, 5min; denaturation, 94°C, 30s; annealing, 55-65°C, 30s; 30cycles; extension, 72°C, 2min; re-extension, 72°C, 10min; 4°C, forever.

[0031] (2) Take 3 μL of the PCR product for agarose gel electrophoresis verific...

Embodiment 2

[0039] Embodiment 2, construction contains the recombinant engineered bacterium of above-mentioned mutant gene TfXyl10A_1

[0040] In this example, the recombinant engineering bacteria containing the above-mentioned mutant gene TfXyl10A_1 were constructed, and the specific steps were as follows: add 2 μL of the above-mentioned mutant plasmid blunt-e1-TfXyl10A-E51A with correct sequencing to 50 μL of Escherichia coli BL-21 competent cells, and ice bath for 30 minutes; 42 Heat shock at ℃ for 90 s; ice bath for 2 min, add 1 mL of liquid LB, incubate in a shaker at 37 °C for 1-1.5 h; centrifuge at 8000 rpm for 2 min, discard the supernatant (leave a little bottom liquid). Spread the remaining solution on an LB plate containing 100 μg / mL ampicillin, spread evenly until dry, and incubate overnight at 37°C; pick a single clone the next day and inoculate it in 5 mL of LB medium containing 100 μg / mL ampicillin , 37°C and 200rpm for overnight culture to obtain recombinant engineering ba...

Embodiment 3

[0041] Embodiment 3: Recombinant expression of mutant gene TfXyl10A_1

[0042] Fermentative expression and purification of the mutant xylanase TfXyl10A_E51A encoded by the above mutant gene TfXyl10A_1, the specific steps are as follows:

[0043] (1) Heterologous expression of recombinant protein:

[0044] Get the recombinant engineered bacterium containing the above-mentioned mutant gene TfXyl10A-1 obtained in Example 2, and cultivate overnight at 37° C. at 200 rpm in 5 mL LB medium (containing 100 μg / mL ampicillin);

[0045] Transfer the cultured bacterial solution overnight to a 1L Erlenmeyer flask containing 300mL LB medium (containing 100μg / mL ampicillin), and culture at 37°C for about 3 hours until OD600=0.6-0.8; the final concentration of adding is 0.5mM IPTG, induced at 20°C for 20h; 8000rpm, centrifuged at 4°C for 10min, to obtain bacterial pellet;

[0046] NaH at pH 8.0 2 PO 4 -Resuspend the bacteria in NaCl buffer, put the bacteria in a 100mL centrifuge tube; put...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutant gene TfXyl10A_1 with CBM2 xylanase TfXyl10A, the mutation site of the gene is E51A, and its nucleotide sequence is shown in SEQ ID No.1. The invention also discloses the application of the gene in preparing xylanase. Experiments have shown that the activity of the mutant xylanase encoded by this gene can reach 84.1U / μmol, which is 100% higher than that of the wild-type enzyme; and the same as the wild-type, the optimum temperature is 80°C, and the optimum pH is 9; The mutant xylanase has the function of quickly removing xylan residues with side chains on the surface of crystalline cellulose, and has the characteristics of high temperature resistance and alkali resistance, and can be widely used in pulp bleaching, oligosaccharide production and Lignocellulose pretreatment and many other fields.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a mutant xylanase and its application. Background technique [0002] Biodegradation of plant biomass is of great importance for the environment and industrial production. Lignocellulose is mainly composed of components such as cellulose, hemicellulose, and lignin. The surface of cellulose is usually covered by hemicellulose and lignin, which together constitute the anti-degradation barrier of plant biomass. Xylan is the main hemicellulose component, its content is second only to cellulose, its main chain is composed of xylose molecules connected by β-1,4-glycosidic bonds, and also contains arabinose, ferulic acid, uronic acid Side chains composed of acid, acetyl groups, etc. In the paper industry, xylan residues with side chains usually cover the surface of cellulose and affect the color of paper. The removal of these residues is usually carried out by chemical b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/70C12N1/21C12P19/14D21C9/10C12R1/19
CPCC12N9/248C12N15/70C12P19/14D21C9/10
Inventor王禄山史泽露
OwnerSHANDONG UNIV