Stem cell preparation modified by long-acting GLP-1 gene, preparation method and application of stem cell preparation

A stem cell preparation, GLP-1 technology, applied to genetically modified cells, cells modified by introducing foreign genetic material, animal cells, etc., can solve problems such as treatment research that has not been reported in the literature

Inactive Publication Date: 2020-12-29
NORTHEAST NORMAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although both basic and clinical studies on GLP-1 and hUC-MSCs in improving glucose metabolism have been carried out, the research on using long-acting GLP-1 gene to modify hUC-MSCs for the treatment of diabetes has not been reported in the literature.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Stem cell preparation modified by long-acting GLP-1 gene, preparation method and application of stem cell preparation
  • Stem cell preparation modified by long-acting GLP-1 gene, preparation method and application of stem cell preparation
  • Stem cell preparation modified by long-acting GLP-1 gene, preparation method and application of stem cell preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Preparation of hUC-MSC modified by embodiment 1 long-acting GLP-1

[0079] 1. Design of GLP-1 gene expression sequence

[0080] According to the gene sequence of GLP-1, the secreted and expressed sequence of GLP-1 was designed, the signal peptide was added before the target gene, the sequence GCCACC was added at the 5' end of the sequence, and the restriction sites at both ends were EcoRI and BamHI.

[0081] The specific sequence is as follows:

[0082] 5'-GAATTCGCCACCATGAAAAGCATTTACTTTGTGGCTGGATTATTTGTAATGCTGGTACAAGGCAGCTGGCAAAAGCGCATCAAGCGCCACCAC GGC GAGGGCACCTTCACCAGCGACGTGAGCAGCTACCTGGAGGGCCAGGCCGCCAAGGAGTTCATCGCCTGGCTGGTGAAGGGCCGCGGCTGAGGATCC-3' (SEQ ID NO. 1)

[0083] The fragment sequences of the designed two complementary cohesive ends are as follows:

[0084] Sense strand: 5'-AATTCGCCACCATGAAAAGCATTTACTTTGTGGCTGGATTATTTGTAATGCTGGTACAAGGCAGCTGGCAAAAGCGCATCAAGCGCCACCACGGCGAGGGCACCTTCACCAGCGACGTGAGCAGCTACCTGGAGGGCCAGGCCGCCAAGGAGTTCATCGCCTGGCTGGTGAAGGGCCGCGGCTGAG...

Embodiment 2

[0132] Preparation of hUC-MSCs preparation of embodiment 2GLP-1 gene modification

[0133] 1. Preparation of stem cell preservation solution: The preservation solution is composed of compound electrolyte injection, which contains 526mg of sodium chloride, 502mg of sodium gluconate, 368mg of sodium acetate, 37mg of potassium chloride and 30mg of magnesium chloride per 100mL.

[0134] 2. Filter the protective solution in step 1, and then add the final concentration of 5×10 5 cells / mL GLP-1 gene-modified hUC-MSCs to prepare cell suspension;

[0135] 3. Add iprafen with a final concentration of 5 mg / mL to the cell suspension in step 2 to prepare a stem cell preparation, and then divide it into 1 mL / bottle.

Embodiment 3

[0136] The therapeutic effect of the hUC-MSCs preparation of embodiment 3GLP-1 gene modification on diabetes

[0137] 1. Establishment of diabetic mouse model

[0138] 100 healthy male C57BL / 6J mice were selected, 10 of which were used as the control group, and 90 were used as the model group, and there was no significant difference in body weight between the mouse groups. Wherein the control group was fed with normal feed, and other mice were fed with 45% high-sugar and high-fat feed for 6 weeks. After 6 weeks, 10 were taken as the high-sugar and high-fat feeding group, and other 80 mice were intraperitoneally injected with small doses of streptozotocin (30mg / kg), after 10 days, the fasting blood glucose > 11mmol / L was detected twice consecutively, which means that the model was established successfully. Select 60 mice with successful modeling, and randomly divide them into 6 groups, 10 in each group, i.e. diabetes model group (injection of stem cell preservation solution),...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Cell densityaaaaaaaaaa
Melting pointaaaaaaaaaa
Melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a stem cell preparation modified by a long-acting GLP-1 gene, a preparation method and application of the stem cell preparation. An in vivo experiment proves that the stem cellpreparation containing a mesenchymal stem cell modified by the GLP-1 gene and ipriflavone has a good function of regulating blood sugar, meanwhile, a urea nitrogen, urine creatinine and urinary albumin excretion rate can be lowered, and a diabetic lower limb ischemia condition and a limb necrosis degree can be obviously lowered. The stem cell preparation disclosed by the invention has a good effect when the stem cell preparation is used for treating diabetes mellitus and complications thereof.

Description

technical field [0001] The invention belongs to the field of biomedicine, and relates to a long-acting GLP-1 gene-modified stem cell preparation, a preparation method and an application thereof. Background technique [0002] In 2019, the International Diabetes Federation (IDF) announced that as of 2019, among people aged 20 to 79, there are about 463 million diabetic patients, among which the number of diabetic patients in China ranks first, with a total of about 116.4 million people. The second is India, with about 77 million diabetics, and the third is the United States, with 31 million diabetics. It is estimated that by 2030, the number of diabetic patients will reach 578.4 million; by 2045, the number of diabetic patients will reach 700.2 million, and the number of diabetic patients in my country is expected to rise to 150 million. According to the estimates of the alliance, the health expenditures related to diabetes in China and the United States are 294.6 billion US ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K35/28A61K38/26A61K31/352A61P3/10A61P3/00A61P3/04A61P3/06A61P1/16A61P31/14A61P31/20A61P5/50A61P9/10A61P9/12A61P27/02A61P25/18A61P13/12A61P7/00A61P17/02C12N5/10C12N15/867C12N15/16
CPCA61K9/0019A61K31/352A61K35/28A61K38/26A61P1/16A61P3/00A61P3/04A61P3/06A61P3/10A61P5/50A61P7/00A61P9/10A61P9/12A61P13/12A61P17/02A61P25/18A61P27/02A61P31/14A61P31/20C07K14/605C12N5/0662C12N5/0668C12N15/86C12N2510/00C12N2740/15043C12N2800/107A61K2300/00
Inventor鲍永利宋振波杨晓光
OwnerNORTHEAST NORMAL UNIVERSITY