Respiratory virus detection kit and method
A detection kit and virus detection technology, applied in biochemical equipment and methods, microbe-based methods, microbiological measurement/testing, etc., can solve problems such as difficulty in prevention and control, hidden onset, and atypical complaints of symptoms, etc. Achieve the effect of increasing the amount of detection samples, reducing false positives, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0038] Kits for detecting SARS-COV-2 coronavirus, including
[0039] (i) virus RNA extraction reagent;
[0040] (ii) detection system qPCR reaction solution;
[0041] (iii) Positive control substance and negative control substance.
[0042] Among them, the virus RNA extraction reagent can be purchased from commercial reagents such as Tiangen RNA extraction kit.
[0043] Detection system qPCR amplification reaction solution includes: ReverTra Ace qPCR RT Kit (TOYOBO); THNDERBIRD Probe qPCR Mix (2×), ORF1ab upstream and downstream primers each 0.8uM, ORF1ab probe 0.4uM; N upper and downstream primers each 0.8uM, N-probe (probe) 0.4uM; Rnase-P upstream and downstream primers each 0.8uM, Rnase-P-probe (probe) 0.4uM; its sequence is:
[0044] ORF1ab-F: TCTGCGGTATGTGGAAAGG
[0045] ORF1ab-R:TTATCATTGTAGATGTCAAAAAGCC
[0046] ORF1ab-probe: FAM-TTGTGATCAACTCCGCGAACCCAT-BHQ1
[0047] N-F: GGCAGTAACCAGAATGGAGAAC
[0048] N-R: ATTTGGTCATCTGGACTGCTATT
[0049] N-probe: FAM-CAAACAA...
Embodiment 2
[0054] The operation flow of Viral Genome DNA / RNA Extraction Kit (Tiangen Biology):
[0055] (1) Extraction of viral DNA / RNA in serum:
[0056] 1) Add 200ul of serum to the centrifuge tube (equilibrium at room temperature).
[0057] 2) Add 20 μl proteinase K solution.
[0058] 3) Add 200 μl carrier RNA working solution and mix well, incubate at 56°C for 15 minutes, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0059] 4) Add 250 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent sediment may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0060] 5) Add the solution and flocculent precipitate obtained in the previous step into an RNase-free adsorption column CR2 (the adsorption column is placed in a collection tube), centrifuge at 8000 rpm for 1 min, discard the waste liquid, and put the adsorption column CR2 back into the collection tube.
[0061] 6) Add 500 μl o...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More