Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Respiratory virus detection kit and method

A detection kit and virus detection technology, applied in biochemical equipment and methods, microbe-based methods, microbiological measurement/testing, etc., can solve problems such as difficulty in prevention and control, hidden onset, and atypical complaints of symptoms, etc. Achieve the effect of increasing the amount of detection samples, reducing false positives, and high sensitivity

Pending Publication Date: 2021-03-26
WUHAN ADICON CLINICAL LAB
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, although the overall fatality rate of COVID-19 that broke out at the end of 2019 is lower than that of SARS, its prevention and control is very difficult due to its more insidious onset, less typical complaint symptoms, and an incubation period of up to 14 days. The global transmission coefficient of SARS CoV-2 is close to 3, higher than that of SARS and MERS

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Kits for detecting SARS-COV-2 coronavirus, including

[0039] (i) virus RNA extraction reagent;

[0040] (ii) detection system qPCR reaction solution;

[0041] (iii) Positive control substance and negative control substance.

[0042] Among them, the virus RNA extraction reagent can be purchased from commercial reagents such as Tiangen RNA extraction kit.

[0043] Detection system qPCR amplification reaction solution includes: ReverTra Ace qPCR RT Kit (TOYOBO); THNDERBIRD Probe qPCR Mix (2×), ORF1ab upstream and downstream primers each 0.8uM, ORF1ab probe 0.4uM; N upper and downstream primers each 0.8uM, N-probe (probe) 0.4uM; Rnase-P upstream and downstream primers each 0.8uM, Rnase-P-probe (probe) 0.4uM; its sequence is:

[0044] ORF1ab-F: TCTGCGGTATGTGGAAAGG

[0045] ORF1ab-R:TTATCATTGTAGATGTCAAAAAGCC

[0046] ORF1ab-probe: FAM-TTGTGATCAACTCCGCGAACCCAT-BHQ1

[0047] N-F: GGCAGTAACCAGAATGGAGAAC

[0048] N-R: ATTTGGTCATCTGGACTGCTATT

[0049] N-probe: FAM-CAAACAA...

Embodiment 2

[0054] The operation flow of Viral Genome DNA / RNA Extraction Kit (Tiangen Biology):

[0055] (1) Extraction of viral DNA / RNA in serum:

[0056] 1) Add 200ul of serum to the centrifuge tube (equilibrium at room temperature).

[0057] 2) Add 20 μl proteinase K solution.

[0058] 3) Add 200 μl carrier RNA working solution and mix well, incubate at 56°C for 15 minutes, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0059] 4) Add 250 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent sediment may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0060] 5) Add the solution and flocculent precipitate obtained in the previous step into an RNase-free adsorption column CR2 (the adsorption column is placed in a collection tube), centrifuge at 8000 rpm for 1 min, discard the waste liquid, and put the adsorption column CR2 back into the collection tube.

[0061] 6) Add 500 μl o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a respiratory virus detection kit. The detection kit is used for detecting ORF1ab area and N region of SARS-COV-2 viruses; the detection kit includes the following primers andprobes: amplification primers ORF1ab-F, ORF1ab-R and ORF1ab-probe used for amplifying the ORF1ab area; and amplification primers N-F, N-R and N-probe used for amplifying the N region. Through the adoption of areal-time fluorescence quantitative PCR technology, the detection kit can be used for rapidly detection whether a to-be-detected sample is a new coronavirus positive sample. Detection resultsare accurate by using the detection kit; and therefore, the detection kit has important reference significance of rapid diagnosis on the infection status of SARS-COV-2 human coronavirus.

Description

technical field [0001] This patent relates to a virus detection kit for clinical testing, which uses probe Taqman real-time fluorescent quantitative PCR technology for nucleic acid detection of SARS-COV-2 virus. The kit adopts double PCR method and uses human internal standard RNase P to effectively control the whole process and reduce false negatives. Background technique [0002] Coronaviruses (Covs) are important pathogens infecting humans and animals, often associated with respiratory and gastrointestinal infections. Covs are balloon-enveloped viruses with a diameter of 100-160 nanometers. Each virus contains a 27-32kb positive-sense single-stranded RNA genome. The viral envelope contains three distinct proteins: membrane protein (m), envelope protein (e), and spike protein (s). The M protein binds to the nucleocapsid and participates in virus assembly and budding, and the E protein participates in virus formation and release. The S protein forms homotrimers that rec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2600/16C12Q2600/166C12Q2531/113C12Q2561/101C12Q2545/101C12Q2537/143
Inventor 林筱剑
Owner WUHAN ADICON CLINICAL LAB
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com