Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for producing octopamine based on tyramine-beta-hydroxylase catalysis

A technology for the production of octopamine catalyzed by hydroxylase, applied in biochemical equipment and methods, oxidoreductase, botanical equipment and methods, etc., can solve pollution and other problems, achieve simple process, low production cost, and mild reaction conditions Effect

Pending Publication Date: 2021-06-04
NANJING UNIV OF TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the deficiencies in the prior art, the present invention provides a method for catalyzing octopamine based on tyramine-β-hydroxylase, the method has mild reaction conditions, is easy to control, has low cost, and has high yield, avoiding the use of environmental or Organic reagents that are toxic and harmful to the human body, solve the pollution problem caused by chemical methods, and have good environmental friendliness

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing octopamine based on tyramine-beta-hydroxylase catalysis
  • Method for producing octopamine based on tyramine-beta-hydroxylase catalysis
  • Method for producing octopamine based on tyramine-beta-hydroxylase catalysis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] A method for catalyzing octopamine based on tyramine-β-hydroxylase, comprising the following steps:

[0023] Step 1, construct the genetically engineered bacteria BL21(DE3) / pET28a-TBH expressing TBH

[0024] According to the reported amino acid sequence of the heterochromia source tyramine-β-hydroxylase (TBH), after codon optimization, the optimized sequence was synthesized from the whole gene,

[0025] (as shown in SEQ NO.1:

[0026]ATGCTGAAAATCCCGCTGCAACTGAGCAGCCAGGATGGTATTTGGCCGGCGCGTTTTGCGCGTCGTCTGCACCACCACCACCAACTGGCGTACCACCACCACAAGCAGGAGCAGCAACAACAGCAGCAACAACAACAACAACAGCAAGCGAAGCAGAAACAAAAGCAGAACGGTGTGCAGCAAGGCCGTAGCCCGACCTTTATGCCGGTTATGCTGCTGCTGCTGATGGCGACCCTGCTGACCCGTCCGCTGAGCGCGTTCAGCAACCGTCTGAGCGATACCAAACTGCACGAGATCTACCTGGACGATAAAGAAATTAAGCTGAGCTGGATGGTGGACTGGTATAAGCAGGAAGTGCTGTTTCACCTGCAAAACGCGTTCAACGAACAGCACCGTTGGTTCTACCTGGGTTTTAGCAAACGTGGTGGCCTGGCGGACGCGGATATCTGCTTCTTTGAGAACCAAAACGGTTTCTTTAACGCGGTGACCGATACCTATACCAGCCCGGATGGCCAGTGGGTGCGTCGTGATTATCAGCAAGACTGC...

Embodiment 2

[0035] Catalytic production of octopamine, the specific operation steps are: take 5ml of the reaction system, take tyramine with an initial concentration of 0.5g / l as the substrate, add 0.5mM ascorbic acid, 0.5mM fumaric acid, 2mM copper ions, 12.5 μg / ml of catalase, adjust the pH of the system to 5 with citric acid-disodium hydrogen phosphate buffer solution, then add 20g / l of crude enzyme concentration, and react with shaking at 50°C.

[0036] After the reaction, use high performance liquid chromatography: XSelect HSS T3 type chromatographic column (4.6 × 250mm, 5μm), mobile phase A is 23.5g sodium chloride, 1ml glacial acetic acid, diluted to 1L with ultrapure water, mobile phase B It is a pure acetonitrile solution, the column temperature is 30°C, the ultraviolet detection wavelength is 280nm, and the flow rate is 0.5ml / min. Take the following gradient elution method:

[0037]

[0038]

[0039] In the above examples, the formula of LB medium: 10g / l peptone, 5g / l yea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing octopamine based on tyramine-beta-hydroxylase catalysis. The method specifically comprises the following steps of generating a genetically engineered bacterium BL21 (DE3) / pET28a-TBH for expressing tyramine-beta-hydroxylase; culturing the genetically engineered bacterium BL21 (DE3) / pET28a-TBH and carrying out induced expression on the TBH; collecting the thalli, resuspending the thalli by using a buffer solution, homogenizing and crushing, and centrifuging to remove impurities, so as to obtain crude enzyme liquid of TBH; and taking tyramine as a substrate, adding ascorbic acid, fumaric acid and copper ions as cofactors, and adding the TBH crude enzyme liquid for a reaction to obtain the product octopamine (under the aerobic condition). The method marks the first time to systematically achieve an enzyme catalysis production process from tyramine to octopamine, the catalysis efficiency reaches up to 20 mg / L, and the method has the advantages of environmental friendliness, easy access to raw materials, low production cost, simple process, and a mild reaction condition. A path is successfully opened, and a good foundation is laid for octopamine production and research in the future.

Description

technical field [0001] The invention belongs to the technical field of preparation of octopamine, and in particular relates to a method for producing octopamine based on catalysis of tyramine-β-hydroxylase. Background technique [0002] Octopamine is one of many trace biogenic amines ubiquitously present in the nervous system of invertebrates. Although first discovered in the salivary glands of the mollusk octopus, the physiological significance of octopamine was first investigated in vertebrates and arthropods. In the vertebrate nervous system, octopamine is considered a "trace biogenic" or "spurious" neurotransmitter. Although there are indications that octopamine is a neurotransmitter that regulates synaptic transmission of norepinephrine, no specific octopamine receptors have been found in the mammalian central nervous system so far. The distribution and content changes of octopamine play an important role in various physiological and biological effects such as growth,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/53C12N9/02C12P13/00
CPCC12N15/70C12N9/0071C12P13/001C12N2800/22
Inventor 陈可泉程莎莎王昕乔荣梅胡鑫峰冯娇张阿磊欧阳平凯
Owner NANJING UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com