Supercharge Your Innovation With Domain-Expert AI Agents!

Pichia pastoris for enhancing lactoferrin expression by adopting double promoters and application of pichia pastoris

A technology of Pichia pastoris and lactoferrin, which is applied in the field of metabolic engineering, can solve problems such as harm, and achieve the effects of increasing expression and reducing dosage.

Pending Publication Date: 2021-06-11
JIANGNAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The promoter Paox1 requires methanol as the sole carbon source for induction, and the application of methanol is potentially harmful in the food industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia pastoris for enhancing lactoferrin expression by adopting double promoters and application of pichia pastoris
  • Pichia pastoris for enhancing lactoferrin expression by adopting double promoters and application of pichia pastoris
  • Pichia pastoris for enhancing lactoferrin expression by adopting double promoters and application of pichia pastoris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Construction of tandem promoters by fusion PCR

[0028] Using the yeast genome as a template, the promoter Pgap was amplified by primers 1 and 2, as shown in Table 1. The PCR products were sequenced and identified. Subsequently, the Pgap promoter and lactoferrin gene were integrated on the pic9k plasmid by means of Gibson assembly to obtain a lactoferrin expression plasmid. The map is as follows figure 1 shown.

[0029] Table 1 Primers for amplifying lactoferrin

[0030]

[0031] In order to change the gap between the two promoters, Gibson assembly method was also used to insert random sequences of different lengths between the two promoters (including 25, 50, 75, 100, 150 and 200bp, nucleotide sequence Such as SEQ ID NO.2~7). Then the recombinant plasmid was transformed into Pichia pastoris by means of electroporation, and then the change of green fluorescent protein fluorescence was detected by fermentation ( figure 2 ). The results showed that wh...

Embodiment 2

[0032] Example 2: Electrotransformation of Pichia pastoris with recombinant plasmids

[0033] Take 80 μL of competent cells and mix them with 10 μL of linearized recombinant plasmid DNA evenly, and transfer them to an ice-bathed 0.2 cm electroporation cuvette at -20°C, and place the electroporation cuvette containing the mixture on ice for 5 min. Adjust the parameters of the electrotransformer, put it in the Pichia pastoris gear, the voltage is 1.5 kV, the capacitance is 25 microfarads, the resistance is 200 ohms, and the time is about 5 milliseconds. After electric shock, quickly add 1ml of 1M sorbitol solution pre-cooled on ice to the transformation cup, gently pipette to mix, and transfer the mixture to a centrifuge tube. Incubate at 30°C for 1-2h, and centrifuge at 3000rpm for 5min. Discard 800 μl of the supernatant, blow the remaining bacteria evenly, smear it on an MD plate, and culture it in a 30°C incubator for 2-4 days until a single colony grows.

Embodiment 3

[0034] Example 3: Determination of tandem promoter transcription levels in recombinant Pichia pastoris

[0035] The transformants obtained above were cultured in BMGY and BMMY respectively, and different concentrations of methanol were added during the cultivation process, and then the bacteria were collected, and liquid nitrogen was rapidly cooled and frozen, and the bacteria were broken with a mortar, and RNA was extracted by Trizol, according to The cDNA was obtained according to the instructions of the reverse transcription kit, and the transcription level of lactoferrin in different bacteria was further determined by a fluorescent quantitative kit. The primer sequences for detecting the transcription level of lactoferrin are shown in Table 2.

[0036] Table 2 Lactoferrin qPCR primer sequence

[0037] Primer 3 TTGGCTGTTGCTGTTGTTAGAAGAT Primer 4 CAGAACCAGGAGCACAAGATTGAG

[0038] To detect the effect of different spacer sequences on the transcription...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to pichia pastoris for enhancing lactoferrin expression by adopting double promoters and application of the pichia pastoris. Paox1 and Pgap series promoters are constructed in a fusion PCR mode, the interval length of the two promoters and the sequence of the promoters are further optimized, and it is found through fermentation experiments that spacer sequences of different lengths cause different transcriptional levels. When the spacer sequence reaches 50bp, compared with a single promoter Paox, the transcription level of the lactoferrin is improved by nearly 6.5 times, and the expression quantity of the lactoferrin is found to be increased by about 3.7 times and reaches 150mg / L through western blot. According to the method, the expression quantity of lactoferrin can be effectively increased, and the use amount of methanol is reduced by 50% or above.

Description

technical field [0001] The invention belongs to the technical field of metabolic engineering, and in particular relates to a Pichia pastoris that adopts double promoters to enhance the expression of lactoferrin and an application thereof. Background technique [0002] Lactoferrin (Lactoferrin, LF) is a non-heme iron-binding protein, a member of the transferrin family, and its function is to transport iron in serum. Lactoferrin has the properties of anti-oxidation, anti-cancer, anti-inflammation and protection against microbial infection by chelating iron or directly interacting with infectious agents. Therefore, LF is considered as a new type of antibacterial and anticancer drug, and LF has been added to many commercial products, including infant formula powder, thermotherapy drinks, fermented milk, cosmetics and toothpaste. The diverse health-promoting functions of LF and its wide application in real life have stimulated increasing research interests. In many countries, l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/81C12N15/67C12N15/12C12P21/02C12R1/84
CPCC07K14/79C12N15/815C12N2830/15
Inventor 刘龙陈坚吕雪芹堵国成李江华刘延峰崔世修
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com