Lilium regale inducible promoter PR4 and application thereof
A promoter, inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve the problems of excessive accumulation of gene products, metabolism, death, disordered plants, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter PR4
[0022] Using the extracted Genomic DNA of Lily of the Minjiang River as a template, use specific primers for amplifying the promoter PR4 (the upstream primer is: 5'CGGTATCTGATAAATTAGTCGTT3', the downstream primer is: 5'GAGAATGGCGTACATGCA3', and the sequence of the promoter PR4 is cloned by PCR. Reaction system (20μL) is 0.5μg Minjiang Lily Genomic DNA, 2μL 10×Advantage 2PCR Buffer, 1.8μL dNTP Mix (10mM each), 0.2μL Upstream Primer (10μM), 0.2μL Downstream Primer (10μM), 0.2μL Advantage 2 PCR Polymerase Mix , 14.6μL PCR-Grade water.PCR reaction conditions: 94°C for 5min; 94°C for 30s, 55°C for 30s, 72°C for 30s, 32 cycles; 72°C for 10min; To detect the specificity and size of the amplified product.
[0023] The PCR product obtained has only one DNA band, and the PCR product is directly cloned by TA. The kit used is pGEM-T vector system (Promega). vector (50ng / μL) and 2.5μL 2×Ligation s...
Embodiment 2
[0024] Example 2: PR4 -GUS Expression vector construction
[0025] The pBI121 multiple cloning site has Hin d III and Bam HI restriction sites, so specific primers for amplifying promoters were added Hin d III and Bam HI recognition site. The E. coli plasmid pGEM-T-PR4 inserted into PR4 and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 3 μL was used for agarose gel electrophoresis to detect the extracted plasmids integrity and concentration. restriction endonuclease Hin d III and Bam HI performed double enzyme digestion on plasmids pGEM-T-PR4 and pBI121 respectively (50 μL system). The reaction system and operation process were as follows: take 25 μL pGEM-T-PR4 and pBI121 plasmids respectively, add 5 μL 10×K buffer, 2.5 μL Bam HI, 2.5 μL Hin d Ⅲ, 15 μL ddH 2 O, after mixing, centrifuge for a short time, and place at 37°C for overnight reaction. All digested products...
Embodiment 3
[0028] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants
[0029] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16h / d light) after germination, and then Subculture once a month with MS medium.
[0030] Store the pBI121-PR4 containing pBI121-PR4 in the -80℃ refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 30 mg / L rifampicin and 50 mg / L kanamycin, and cultured with shaking at 28 °C and 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 30 mg / L rifampicin and 50 mg / L kanamycin, and...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap