Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lilium regale inducible promoter PR4 and application thereof

A promoter, inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve the problems of excessive accumulation of gene products, metabolism, death, disordered plants, etc.

Active Publication Date: 2021-07-27
KUNMING UNIV OF SCI & TECH
View PDF11 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the constitutive promoters used in traditional genetic engineering are highly expressed throughout the life cycle of plants, which may lead to excessive accumulation of gene products and subsequent metabolic disorders and even plant death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lilium regale inducible promoter PR4 and application thereof
  • Lilium regale inducible promoter PR4 and application thereof
  • Lilium regale inducible promoter PR4 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter PR4

[0022] Using the extracted Genomic DNA of Lily of the Minjiang River as a template, use specific primers for amplifying the promoter PR4 (the upstream primer is: 5'CGGTATCTGATAAATTAGTCGTT3', the downstream primer is: 5'GAGAATGGCGTACATGCA3', and the sequence of the promoter PR4 is cloned by PCR. Reaction system (20μL) is 0.5μg Minjiang Lily Genomic DNA, 2μL 10×Advantage 2PCR Buffer, 1.8μL dNTP Mix (10mM each), 0.2μL Upstream Primer (10μM), 0.2μL Downstream Primer (10μM), 0.2μL Advantage 2 PCR Polymerase Mix , 14.6μL PCR-Grade water.PCR reaction conditions: 94°C for 5min; 94°C for 30s, 55°C for 30s, 72°C for 30s, 32 cycles; 72°C for 10min; To detect the specificity and size of the amplified product.

[0023] The PCR product obtained has only one DNA band, and the PCR product is directly cloned by TA. The kit used is pGEM-T vector system (Promega). vector (50ng / μL) and 2.5μL 2×Ligation s...

Embodiment 2

[0024] Example 2: PR4 -GUS Expression vector construction

[0025] The pBI121 multiple cloning site has Hin d III and Bam HI restriction sites, so specific primers for amplifying promoters were added Hin d III and Bam HI recognition site. The E. coli plasmid pGEM-T-PR4 inserted into PR4 and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 3 μL was used for agarose gel electrophoresis to detect the extracted plasmids integrity and concentration. restriction endonuclease Hin d III and Bam HI performed double enzyme digestion on plasmids pGEM-T-PR4 and pBI121 respectively (50 μL system). The reaction system and operation process were as follows: take 25 μL pGEM-T-PR4 and pBI121 plasmids respectively, add 5 μL 10×K buffer, 2.5 μL Bam HI, 2.5 μL Hin d Ⅲ, 15 μL ddH 2 O, after mixing, centrifuge for a short time, and place at 37°C for overnight reaction. All digested products...

Embodiment 3

[0028] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants

[0029] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16h / d light) after germination, and then Subculture once a month with MS medium.

[0030] Store the pBI121-PR4 containing pBI121-PR4 in the -80℃ refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 30 mg / L rifampicin and 50 mg / L kanamycin, and cultured with shaking at 28 °C and 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 30 mg / L rifampicin and 50 mg / L kanamycin, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lilium regale inducible promoter PR4 and application thereof, the nucleotide sequence of the PR4 is shown as SEQ ID NO: 1, and the lilium regale inducible promoter PR4 is proved to respond to several plant hormones and biological stress through molecular biology and genetic engineering related technical research; and a fusion expression cassette constructed by the lilium regale promoter PR4 and a beta-glucuronidase gene is transferred into tobacco for expression, and the glucuronidase activity of transgenic tobacco is quantitatively detected through a fluorescence method. Results show that after the transgenic tobacco is treated by methyl jasmonate, salicylic acid, fusarium oxysporum, alternaria alternata and fusarium chlamydosporum, the activity of glucosidase is obviously enhanced; therefore, the lilium regale promoter PR4 is a promoter induced by plant hormones and biological stress factors and can be used for plant disease-resistant gene engineering.

Description

technical field [0001] The invention relates to the research fields of molecular biology and genetic engineering, in particular to an inducible promoter PR4 and its application. Background technique [0002] A promoter is a DNA sequence located in the upstream region of a gene that regulates gene transcription. It is an important cis-regulatory factor that determines the temporal and spatial accuracy and transcription efficiency of gene transcription, thereby regulating the expression of downstream genes. The promoter composition includes the core promoter and upstream promoter elements. The core promoter consists of a transcription initiation site, a TATA box, and a 5'UTR sequence. Upstream promoter elements include CAAT box, GC box, and some constitutive and specific elements, which can improve transcription efficiency by binding corresponding protein factors. The promoters of plant genes can be divided into constitutive promoters, inducible promoters and tissue-specific...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/84A01H5/00A01H6/82
CPCC07K14/415C12N15/8238C12N15/8239C12N15/8282
Inventor 刘迪秋海军王自娥邓婕梁婷婷苏琳琳曲媛葛锋
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com