Drought-enduring protein and application of encoding gene thereof in cultivation of drought-enduring plants

A gene and protein technology is applied in the application field of drought-tolerant protein and its encoding gene in breeding drought-tolerant plants, which can solve the problems of complex genetic background, large genetic variation, and long genetic transformation period of alfalfa.

Active Publication Date: 2021-09-14
LANZHOU UNIVERSITY
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are three main factors restricting the study of alfalfa drought-tolerant genes: ① no mutant pool, perennial, and long genetic transformation cycle; ② although the genome has been published, its gene annotation information still needs to be optimized; ③ cross-pollination, compounding with alfalfa There is extensive gene flow among other subspecies of alfalfa, resulting in complex genetic background and large genetic variation of alfalfa

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drought-enduring protein and application of encoding gene thereof in cultivation of drought-enduring plants
  • Drought-enduring protein and application of encoding gene thereof in cultivation of drought-enduring plants
  • Drought-enduring protein and application of encoding gene thereof in cultivation of drought-enduring plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] This embodiment carries out cloning and sequencing MsDINP1 gene, comprises the following steps:

[0053] Plant material: Alfalfa No. 1

[0054] Under normal conditions, the healthy and plump seeds were germinated in a petri dish covered with double-layer filter paper for 5 days, and when the cotyledons of the seedlings were unfolded, they were transferred to the prepared 1 / 2MS nutrient solution (pH=5.8). After 7 days of cultivation, Mannitol was added to 1 / 2MS nutrient solution to a final concentration of 300mM, and treated for 24 hours. The above-ground and underground parts of the plants were quickly taken, quickly frozen in liquid nitrogen, and stored at -80°C for later use.

[0055] The RNA of the sample was extracted by Trizol method, and the RNA was reverse transcribed into cDNA by cDNA synthesis reverse transcription kit; at the same time, the DNA was extracted by CTAB method. The total volume of the PCR amplification system is 50 μL, including 10 μL of 5×Phusio...

Embodiment 2

[0059] This embodiment analyzes the expression characteristics of MsDINP1 by real-time fluorescent quantitative PCR, including the following steps:

[0060] Alfalfa seed germination and hydroponics are the same as in Example 1, and the alfalfa seedlings of 12 days are used for stress treatment:

[0061] Drought treatment: Mannitol was added to 1 / 2MS hydroponic nutrient solution to a final concentration of 500mM, and the treatment time was 0h, 1h, 3h, 6h, 12h and 24h, respectively. The above-ground and underground parts of the plants were quickly taken respectively, and the samples were quickly frozen in liquid nitrogen and stored at -80°C for later use.

[0062] Phytohormone abscisic acid treatment: add 80μM ABA to 1 / 2MS hydroponic nutrient solution, and treat for 0h, 1h, 3h, 6h, 12h and 24h respectively. The ground and underground samples were taken separately, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0063] Sample RNA extraction and reverse tra...

Embodiment 3

[0067] This example verifies the application of MsDINP1 in improving the stress resistance of Arabidopsis thaliana.

[0068] It is worth noting that: as a model plant, the present invention uses Arabidopsis to analyze and verify the function of the MsDINP1 gene, and the conclusion can be considered to be equivalent to the molecular mechanism of MsDINP1 in alfalfa regulating plant response to drought.

[0069] The experimental operation of this embodiment includes the following steps:

[0070] 1. Preparation of transgenic Arabidopsis thaliana.

[0071] 1. Construction of the recombinant vector.

[0072] 1) Cloning of MsDINP1 gene

[0073] Primers MsDINP1-G-F and MsDINP1-G-R were designed according to the sequence of the MsDINP1 gene, and the 5' ends of the primers were introduced with NcoI and XbaI restriction sites:

[0074] MsDINP1-G-F(5'-3'): CATGCCATGTGTTGCTGTTGTGGTGAAG (SEQ ID No. 8)

[0075] MsDINP1-G-R(5'-3'): CTAGTCTATTAACATGGAATCTTGGATGTG (SEQ ID No.9)

[0076] Us...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a drought-enduring protein and application of a encoding gene thereof in cultivation of drought-enduring plants, and relates to the technical field of biology. The drought-enduring gene disclosed by the invention encodes a protein shown as SEQ ID NO.1. The drought-enduring gene and the encoded protein thereof disclosed by the invention have a drought-enduring function and can be used for cultivating drought-enduring plants or microorganisms, a new gene resource is provided for designing and breeding drought-enduring molecules of medicago sativa, the drought-enduring gene and the encoded protein thereof play an important role in cultivation of new alfalfa drought-resistant materials, a new scheme is provided for improvement of drought-resistant characters of other non-grain commercial crops, and substantial influence is generated on animal husbandry, agriculture, forestry and the like in China.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of a drought-tolerant protein and its coding gene in cultivating drought-tolerant plants. Background technique [0002] Alfalfa (Medicago sativa) is one of the most planted forage grasses in the world. It is known as the "king of forage grasses" (Triboi and Triboi-Blondel, 2014) because of its nutritional value and high aboveground biomass, and it is the fourth largest grass in the United States. big crops. In my country, alfalfa is grown mainly in northwest, north and northeast regions (Yang Qingchuan et al., 2016). The increasing drought has become the most important factor restricting the growth and production of alfalfa (Song et al., 2016; Luo et al., 2019). [0003] Drought refers to a long-term lack of rain or high temperature and little rain in a certain area, which makes the air and soil lack of moisture. The occurrence of drought is mainly related to spora...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/70C12N15/84C12N1/21A01H5/10A01H6/20C12R1/19
CPCC07K14/415C12N15/70C12N15/8273C12N15/8205
Inventor周强刘志鹏罗栋
OwnerLANZHOU UNIVERSITY