Drought-enduring protein and application of encoding gene thereof in cultivation of drought-enduring plants
A gene and protein technology is applied in the application field of drought-tolerant protein and its encoding gene in breeding drought-tolerant plants, which can solve the problems of complex genetic background, large genetic variation, and long genetic transformation period of alfalfa.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] This embodiment carries out cloning and sequencing MsDINP1 gene, comprises the following steps:
[0053] Plant material: Alfalfa No. 1
[0054] Under normal conditions, the healthy and plump seeds were germinated in a petri dish covered with double-layer filter paper for 5 days, and when the cotyledons of the seedlings were unfolded, they were transferred to the prepared 1 / 2MS nutrient solution (pH=5.8). After 7 days of cultivation, Mannitol was added to 1 / 2MS nutrient solution to a final concentration of 300mM, and treated for 24 hours. The above-ground and underground parts of the plants were quickly taken, quickly frozen in liquid nitrogen, and stored at -80°C for later use.
[0055] The RNA of the sample was extracted by Trizol method, and the RNA was reverse transcribed into cDNA by cDNA synthesis reverse transcription kit; at the same time, the DNA was extracted by CTAB method. The total volume of the PCR amplification system is 50 μL, including 10 μL of 5×Phusio...
Embodiment 2
[0059] This embodiment analyzes the expression characteristics of MsDINP1 by real-time fluorescent quantitative PCR, including the following steps:
[0060] Alfalfa seed germination and hydroponics are the same as in Example 1, and the alfalfa seedlings of 12 days are used for stress treatment:
[0061] Drought treatment: Mannitol was added to 1 / 2MS hydroponic nutrient solution to a final concentration of 500mM, and the treatment time was 0h, 1h, 3h, 6h, 12h and 24h, respectively. The above-ground and underground parts of the plants were quickly taken respectively, and the samples were quickly frozen in liquid nitrogen and stored at -80°C for later use.
[0062] Phytohormone abscisic acid treatment: add 80μM ABA to 1 / 2MS hydroponic nutrient solution, and treat for 0h, 1h, 3h, 6h, 12h and 24h respectively. The ground and underground samples were taken separately, quick-frozen in liquid nitrogen, and stored at -80°C for later use.
[0063] Sample RNA extraction and reverse tra...
Embodiment 3
[0067] This example verifies the application of MsDINP1 in improving the stress resistance of Arabidopsis thaliana.
[0068] It is worth noting that: as a model plant, the present invention uses Arabidopsis to analyze and verify the function of the MsDINP1 gene, and the conclusion can be considered to be equivalent to the molecular mechanism of MsDINP1 in alfalfa regulating plant response to drought.
[0069] The experimental operation of this embodiment includes the following steps:
[0070] 1. Preparation of transgenic Arabidopsis thaliana.
[0071] 1. Construction of the recombinant vector.
[0072] 1) Cloning of MsDINP1 gene
[0073] Primers MsDINP1-G-F and MsDINP1-G-R were designed according to the sequence of the MsDINP1 gene, and the 5' ends of the primers were introduced with NcoI and XbaI restriction sites:
[0074] MsDINP1-G-F(5'-3'): CATGCCATGTGTTGCTGTTGTGGTGAAG (SEQ ID No. 8)
[0075] MsDINP1-G-R(5'-3'): CTAGTCTATTAACATGGAATCTTGGATGTG (SEQ ID No.9)
[0076] Us...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



