Porcine circovirus type 3 virus-like particle as well as preparation method and application thereof
A porcine circovirus, virus-like technology, applied in the biological field, can solve the problems of complex procedures, unoptimized codon insertion of Cap gene, and poor immunogenicity of virus-like particles.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] The construction of embodiment 1 recombinant virus
[0047] The specific technical route for recombinant baculovirus acquisition is as follows:
[0048] 1. Obtain the Cap protein coding sequence
[0049] S1. Design forward and reverse amplification primers, respectively 5'-TAA GGATCC AATCATGCGTCACCGTGCTATCTTCCGTCGCCGTTCCCGCCCTAGGAGACGTCGACGCCACAGAAGGCGCTACGTGCGCCGCAAGCTGTTCATCCGCCGCCCCACAGCTGGCACATACTACACCAA-3' (the underline represents the BamHI restriction site, italics represents the nucleotide sequence inserted between the restriction site and the ATG start codon) and 5'-GAC AAGCTT TTACAGCACGCTCTTGTACCTGATCCA-3' (the underline indicates the HindIII restriction enzyme site), and the sequence synthesis was completed by Wuhan Qingke Biological Company.
[0050] S2, using the pFastdual-PCV3 ORF2 recombinant transfer vector disclosed in CN111558037A as a template, using the forward and reverse primers in step S1, using PrimerSTAR Max DNA Polymerase (Bao Biological En...
Embodiment 2
[0072] Embodiment 2 Recombinant virus and the identification of expressing Cap
[0073] To identify recombinant viruses, use indirect immunization and Western blot:
[0074] The main process of indirect immunization is as follows: in a 24-well plate, inoculate 1×10 5 cell, then infect Bac-PCV3-Cap-FL, Bac-PP6-PCV3-P6-Cap or Bac-PCV2-Cap (the baculovirus expressing PCV2 Cap protein is constructed and preserved by Wuhan Keqian Biotechnology Co., Ltd.), while Healthy Sf9 cells (Mock) without virus infection were used as blank control. At 72 hours after virus infection, the cells were fixed with 4% paraformaldehyde solution for 10 minutes, then permeabilized with 0.2% Triton X-100 solution for 10 minutes, and blocked with 5% BSA at room temperature for 3 hours, and then polyclonal anti-PCV3 Cap protein The antibody and the cells were blocked at room temperature for 3 hours, washed gently with PBS for 3 times, then blocked with fluorescently labeled goat anti-mouse IgG secondary ...
Embodiment 3
[0084] Embodiment 3 Electron microscope observation
[0085] The density of 200mL is 2×10 6 The Sf9 cells in cell / mL were infected with Bac-PCV3-Cap-FL and Bac-PP6-PCV3-P6-Cap respectively, and the inoculated dose was 0.5moi. On the 4th day of infection, the expression of Cap was detected by SDS-PAGE, see Figure 4 Medium 1). After the infected cells were broken (8 days after infection), the cell culture fluid was collected, centrifuged at 10,000 g for 0.5 h to remove cell debris, and the supernatant was taken, centrifuged at 200,000 g for 2 h, and then washed with double distilled water (ddH 2 O) Resuspend the pellet, then pass through a 25%-45% sucrose density gradient, centrifuge at 180,000g for 2h, take the sediment at the bottom of the centrifuge tube, and use ddH 2 O resuspended, then negatively stained with phosphotungstate, and then observed by electron microscopy, see Figure 5 Medium 1).
[0086] Electron microscopy results showed that both expression strategies...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com