Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porcine circovirus type 3 virus-like particle as well as preparation method and application thereof

A porcine circovirus, virus-like technology, applied in the biological field, can solve the problems of complex procedures, unoptimized codon insertion of Cap gene, and poor immunogenicity of virus-like particles.

Active Publication Date: 2021-09-21
WUHAN KEQIAN BIOLOGY CO LTD
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, although the full-length and N-terminal 32 amino acid truncated Cap proteins are expressed in baculovirus and can form VLP (virus-like particle), the amino acids 1-32 of the N-terminus of the Cap protein are rich in basic Amino acid, which can mediate the nuclear transport of Cap protein, the expression of the complete Cap protein may affect its expression in the expression system, but the deletion of the entire segment may affect the characteristics of the surface of the virus-like particle and the characteristics of the virus-like particle Stability, thus affecting its immunogenicity
Initial research found that the expression level of the complete PCV3 Cap protein and the Cap protein lacking 32 amino acids at the N-terminal is extremely low in insect cells, which cannot meet the needs of industrialization
In addition, in the above scheme using the baculovirus expression system, only the codon-unoptimized Cap gene was inserted into the expression vector, and no other elements were added or the vector was modified to further increase the expression of the protein.
[0005] In summary, the research and development of PCV3 Cap virus-like particles is of great significance, but in the current expression of Cap protein, the process of prokaryotic expression system is relatively complicated, the protein has no post-translational modification, and the immunogenicity of virus-like particles obtained is poorer than that of eukaryotic expression. , while the yeast expression system has low secretion expression, and the insect-baculovirus expression system still needs to be further optimized and improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine circovirus type 3 virus-like particle as well as preparation method and application thereof
  • Porcine circovirus type 3 virus-like particle as well as preparation method and application thereof
  • Porcine circovirus type 3 virus-like particle as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The construction of embodiment 1 recombinant virus

[0047] The specific technical route for recombinant baculovirus acquisition is as follows:

[0048] 1. Obtain the Cap protein coding sequence

[0049] S1. Design forward and reverse amplification primers, respectively 5'-TAA GGATCC AATCATGCGTCACCGTGCTATCTTCCGTCGCCGTTCCCGCCCTAGGAGACGTCGACGCCACAGAAGGCGCTACGTGCGCCGCAAGCTGTTCATCCGCCGCCCCACAGCTGGCACATACTACACCAA-3' (the underline represents the BamHI restriction site, italics represents the nucleotide sequence inserted between the restriction site and the ATG start codon) and 5'-GAC AAGCTT TTACAGCACGCTCTTGTACCTGATCCA-3' (the underline indicates the HindIII restriction enzyme site), and the sequence synthesis was completed by Wuhan Qingke Biological Company.

[0050] S2, using the pFastdual-PCV3 ORF2 recombinant transfer vector disclosed in CN111558037A as a template, using the forward and reverse primers in step S1, using PrimerSTAR Max DNA Polymerase (Bao Biological En...

Embodiment 2

[0072] Embodiment 2 Recombinant virus and the identification of expressing Cap

[0073] To identify recombinant viruses, use indirect immunization and Western blot:

[0074] The main process of indirect immunization is as follows: in a 24-well plate, inoculate 1×10 5 cell, then infect Bac-PCV3-Cap-FL, Bac-PP6-PCV3-P6-Cap or Bac-PCV2-Cap (the baculovirus expressing PCV2 Cap protein is constructed and preserved by Wuhan Keqian Biotechnology Co., Ltd.), while Healthy Sf9 cells (Mock) without virus infection were used as blank control. At 72 hours after virus infection, the cells were fixed with 4% paraformaldehyde solution for 10 minutes, then permeabilized with 0.2% Triton X-100 solution for 10 minutes, and blocked with 5% BSA at room temperature for 3 hours, and then polyclonal anti-PCV3 Cap protein The antibody and the cells were blocked at room temperature for 3 hours, washed gently with PBS for 3 times, then blocked with fluorescently labeled goat anti-mouse IgG secondary ...

Embodiment 3

[0084] Embodiment 3 Electron microscope observation

[0085] The density of 200mL is 2×10 6 The Sf9 cells in cell / mL were infected with Bac-PCV3-Cap-FL and Bac-PP6-PCV3-P6-Cap respectively, and the inoculated dose was 0.5moi. On the 4th day of infection, the expression of Cap was detected by SDS-PAGE, see Figure 4 Medium 1). After the infected cells were broken (8 days after infection), the cell culture fluid was collected, centrifuged at 10,000 g for 0.5 h to remove cell debris, and the supernatant was taken, centrifuged at 200,000 g for 2 h, and then washed with double distilled water (ddH 2 O) Resuspend the pellet, then pass through a 25%-45% sucrose density gradient, centrifuge at 180,000g for 2h, take the sediment at the bottom of the centrifuge tube, and use ddH 2 O resuspended, then negatively stained with phosphotungstate, and then observed by electron microscopy, see Figure 5 Medium 1).

[0086] Electron microscopy results showed that both expression strategies...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a porcine circovirus type 3 virus-like particle as well as a preparation method and application thereof. According to the invention, an insect-baculovirus expression system is utilized to express a PCV3 Cap protein variant so as to prepare virus-like particles. According to the invention, double promoters of baculovirus are used to start Cap protein expression, on the basis of keeping the N terminal of the Cap protein rich in basic amino acid, the first to 22th amino acids are deleted, and a sequence for coding the basic protein P6.9 N terminal rich in basic amino acid of the baculovirus is inserted, so that the Cap protein is expressed in a fusion manner. Results show that the expressed fusion protein not only can form the virus-like particles, but also can be expressed at a relatively high level, and a basis is provided for further development of PCV3 vaccines and realization of industrial production of the PCV3 virus-like particles.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a porcine circovirus type 3 virus-like particle and a preparation method and application thereof. Background technique [0002] Porcine circovirus (Porcine circovirus, PCV) belongs to Circoviridae (Circoviridae) genus Circovirus (Circovirus), contains a single strand of circular DNA, is one of the smallest animal DNA viruses, first in 1974 in pig kidney cells line (PK-15 cell line). At present, four genotypes of PCV have been found, namely PCV1, PCV2, PCV3, and PCV4. PCV1 is non-pathogenic, and PCV4 is a new genotype discovered in 2019, and its pathogenicity needs further study. PCV2 can infect monocytes, macrophages, etc., causing immune cell damage in pigs, leading to severe immunosuppression in infected pigs, resulting in postweaning multisystemic wasting syndrome (PMWS) and dermatitis and nephrotic syndrome (PDNS). , proliferative necrotizing interstitial pneumonia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/01C07K16/08C12N15/34C12N15/866A61K39/12A61P31/20G01N33/577G01N33/569
CPCC07K14/005C07K16/081C12N15/86A61K39/12A61P31/20G01N33/56983G01N33/577C12N2750/10022C12N2750/10023C12N2750/10034C12N2710/14043A61K2039/5258A61K2039/552G01N2333/01
Inventor 邵伟徐高原孙婉莹陈清秀张华伟曾小燕汤细彪周明光金建云陈章表
Owner WUHAN KEQIAN BIOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products