Methods and drugs for targeted editing of RNA based on leaper technology

A targeting and editing technology, applied in DNA/RNA fragments, recombinant DNA technology, other methods of inserting foreign genetic materials, etc., can solve the problems of low editing efficiency, short complementary RNA length, complex chemical modification, etc. Efficient effect

Active Publication Date: 2022-05-17
EDIGENE INC
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

First, exogenously expressed nucleases are often required to have a large molecular weight, which drastically reduces the efficiency of their delivery into the body by viral vectors
Secondly, due to the exogenous expression of nucleases, there is a potential nuclease off-target possibility, which will make its application a potential carcinogenic risk
Finally, exogenously expressed nucleases are found in bacteria and not naturally occurring in humans or mammals, which makes it possible to elicit an immune response in the patient, which may cause damage to the patient itself, or It may also neutralize exogenously expressed nucleases, thereby losing their proper activity or hindering further therapeutic interventions
[0006] In 2017, Zhang Feng's research group reported an RNA editing technology called REPAIR (RNA Editing for Programmable Ato I Replacement) (RNA editing with CRISPR-Cas13, Cox et al., 2017), which expresses Cas13 exogenously -ADAR fusion protein and a single guide RNA (single guide RNA, sgRNA) can also achieve the editing from A to I of the target RNA, but this method, like CRISPR technology, still requires the expression of foreign proteins
The complementary RNA used in this method is short (less than 54nt), but requires complex chemical modifications, and the editing efficiency is not high
However, the RESTORE technology requires the presence of IFN-γ to have high editing efficiency, and IFN-γ is a key factor determining the development and severity of autoimmunity (Interferon-γ and systemic autoimmunity., Pollard et al., 2013, This makes the application of the technology in the medical field greatly discounted

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods and drugs for targeted editing of RNA based on leaper technology
  • Methods and drugs for targeted editing of RNA based on leaper technology
  • Methods and drugs for targeted editing of RNA based on leaper technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0260] Example 1: Detection of GM06214 mutant genotype

[0261] Put GM06214 cells into the fibroblast culture medium (ScienCell, FM medium, product number: 2301) containing 15% serum, add 1% fibroblast growth supplement (ScienCell, GFS, product number: 2301), at 37 ℃ , 5%CO 2Cultivate in the incubator for 2-3 days. When the cell confluency reached 90%, it was digested with 0.25% trypsin, and then the digestion was terminated with fibroblast culture medium containing 15% serum. use (TIANGEN Biotech (Beijing) Co., Ltd.) Cellular DNA Extraction Kit (Product No.: DP304-03) was used for DNA extraction according to the operating instructions.

[0262] NCBI-Primer blast (URL: https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used to design primers for the upstream and downstream sequences of the IDUA target site. SEQ ID NO 1: CGCTTCCAGGTCAACAACAC (forward primer hIDUA-F1); SEQ ID NO 2: CTCGCGTAGATCAGCACCG (reverse primer hIDUA-R1). The PCR reaction was carried out, and the ...

Embodiment 2

[0263] Example 2: Detection of IDUA enzyme activity and editing efficiency after electrotransfection of arRNA in GM06214 cells

[0264] For the upstream and downstream sequences of the mRNA precursor (pre-mRNA) and mature mRNA target sites after IDUA gene transcription, the following arRNA sequences were designed and synthesized:

[0265] Targeted arRNA against pre-mRNA:

[0266] GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCGGCCUGCGAC ACUUCGGCCCAGAGCUGCUCCUCAUCCAGCAGCGCCAGCAGCCCCAUGGCCGUGAGCACCGGCUU (SEQ ID NO: 3, Pre-55nt-c-55nt);

[0267] Targeted arRNA against mature mRNA:

[0268] GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCGGCCUGCGAC ACUUCGGCCCAGAGCUGCUCCUCAUCUGCGGGGCGGGGGGGGCCGUCGCCGCGUGGGGUCGUUG (SEQ ID NO: 4, m-55nt-c-55nt);

[0269] Randomly designed non-targeting arRNA:

[0270] UACCGCUACAGCCACGCUGAUUUCAGCUAUACCUGCCCGGUAUAAA GGGACGUUCACACCGCGAUGUUCUCUGCUGGGGAAUUGCGCGAUAUUCAGGAUUAAAAGAAGUGC (SEQ ID NO: 5, Random-111nt)

[0271] Wherein, the base in the arRNA for the mutation site ...

Embodiment 3

[0288] Example 3: Detection of IDUA target site editing efficiency after electrotransfection of arRNA on IDUA-reporter cell line

[0289] Such as Figure 3A As shown, a segment containing human (NM_000203.4(IDUA)-c.1205G>A (p.Trp402Ter))(IDUA)_c.1239G>A( p.Trp402Ter) mutation site and the IDUA gene transcript sequence of about 100 bp upstream and downstream respectively to construct a plasmid. The above constructed plasmid was packaged into a virus, infected 293T cells, and after it was integrated into the genome, IDUA-reporter monoclonal cells were screened out. This monoclonal cell only expresses mcherry protein due to the influence of the TAG stop codon where the IDUA target adenosine is located in the inserted sequence, and when the cell is edited by arRNA, it changes from TAG to TGG, so the subsequent GFP protein can be expressed normally . The positive cell ratio of GFP protein can reflect the editing efficiency of arRNA-edited cells. We preferably designed 4 (25nt-c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
recovery rateaaaaaaaaaa
recovery rateaaaaaaaaaa
Login to View More

Abstract

The present application relates to a nucleic acid drug based on LEAPER technology, and a method for using the nucleic acid drug to target editing RNA to treat diseases such as Hurler syndrome. The method includes using the nucleic acid drug to edit the base from adenosine to hypoxanthine on the RNA, accurately repairing the pathogenic G>A mutation site such as Hurler syndrome, and restoring The normal expression of the encoded protein such as IDUA in vivo.

Description

technical field [0001] The present application belongs to the field of gene editing therapy, and in particular, relates to a method for editing RNA based on LEAPER (Leveraging Endogenous ADAR for Programmable Editing on RNA) technology and repairing disease-causing mutations, which includes using LEAPER technology to perform on RNA from A to Site-directed editing of I bases to prevent or treat diseases caused by G>A mutations such as Herler's syndrome. Background technique [0002] Hurler syndrome (Hurler syndrome), also known as mucopolysaccharide storage disease IH type (Mucopolysaccharides IH, MPS IH), is the most serious of the three subtypes IH, IH / S, and IS of MPSI type. It is an autosomal recessive genetic disease (autosomal recessive genetic disease), which is caused by the deficiency of α-L-iduronidase (IDUA) in the body of the patient recessive, AR). The root cause of Heller's syndrome is the mutation of the IDUA gene encoding the IDUA protein located at 4p16....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/87C12N15/56C12N15/113A61K48/00A61P3/00
CPCC12N15/87C12N9/2402C12N15/1137A61K48/005A61P3/00C12Y302/01076C12N2310/20C12N2310/315C12N2310/321C12N2310/3521C12N2310/3525C12N2310/3231C12N2310/3235
Inventor袁鹏飞赵艳霞刘能银易泽轩汤刚彬
OwnerEDIGENE INC