Application of Candidatus Liberibacter asiaticum effector as target for screening anti-Candidatus Liberibacter asiaticum drugs

A technology of citrus huanglongbing bacteria and citrus huanglongbing, which is applied in the field of microorganisms to achieve the effects of small genome, simple cultivation, and stable genetic operation

Active Publication Date: 2021-12-31
SOUTH CHINA AGRI UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CN201910663478.5 discloses a two-step method for screening citrus huanglongbing biocontrol bacteria, but it is suitable for citrus huanglongbing biocontrol bacteria, and currently lacks a method for screening new drugs that can effectively antagonize citrus huanglongbing bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Candidatus Liberibacter asiaticum effector as target for screening anti-Candidatus Liberibacter asiaticum drugs
  • Application of Candidatus Liberibacter asiaticum effector as target for screening anti-Candidatus Liberibacter asiaticum drugs
  • Application of Candidatus Liberibacter asiaticum effector as target for screening anti-Candidatus Liberibacter asiaticum drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction of Yeast Expression Strain Containing CLa1305 Effector

[0041] 1. PCR amplification of the target fragment

[0042] The citrus huanglongbing Asian strain psy62 genomic DNA was used as a template to amplify the fragment of CLIBASIA——01305 gene (CLa1305, encoding the P-ring protein of the flagellar substrate GenBank: ACT56849.1), and the reaction system is shown in Table 1, wherein the upstream primer F : CTTGGTACCGAGCTCGGATCCATGATTTTTCGTATAGCTTTTTTGATTTTTTC, downstream primer R: TGCTGGATATCTGCAGAATTCTTGAATTATAATCTCTGATTGAAGGGCGCCCG,.

[0043] Table 1 PCR reaction system:

[0044]

[0045] The PCR amplification conditions were: 95°C pre-denaturation for 2 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 3 min, a total of 30 cycles, 72°C extension for 5 min, and 12°C storage.

[0046] 2. Connection conversion

[0047] After the PCR reaction, the PCR product was detected by 1% agarose gel electrophoresis, purified an...

Embodiment 2

[0050] Example 2 Detection of Effects of CLa1305 Effectors on Saccharomyces cerevisiae Cell Growth Phenotype

[0051] 1. Experimental method

[0052] The yeast strain p-1305 prepared in Example 1 was taken out from -80°C, as well as the positive control strain p-exoY (expressing the toxin ExoY secreted by the Pseudomonas aeruginosa type III secretion system) and the negative control strain carrying the pYES3 empty vector, respectively. Streak activation on tryptophan-deficient plate SD-T plate, culture at 30°C for 2 days, take a single colony and culture in 3ml SD-T liquid medium overnight at 30°C. Take 2ml of overnight culture bacteria solution, wash twice with double distilled water, and adjust the OD600 of the bacteria solution to 1.0. Dilute 5 times with a gradient of 10, take 15 μl and spot on SD Trp inhibition medium and SC-Trp induction medium respectively, culture at 30°C for 2 to 3 days, observe the growth status, and take pictures for records.

[0053] 2. Experimen...

Embodiment 3

[0055] Example 3 Determination of the Effect of Expression of CLa1305 Effector on Yeast Cell Viability

[0056] 1. Experimental method

[0057] Yeast single colonies p-1305 and pYES3 prepared in Example 1 carrying the candidate effector CLa1305 and the empty plasmid were cultured overnight in 3 ml of suppression medium SD-T, 30° C., 250 rpm. Take the overnight culture solution at 10,000 rpm, centrifuge for 3 minutes to remove the supernatant, resuspend with fresh SD-T medium, and adjust the OD600 to 0.5. After continuing to culture for 2 hours, centrifuge at 10,000 rpm for 3 minutes to remove the supernatant, resuspend with SC-T medium, adjust OD600 to 0.2, and culture at 30°C for 55 hours. Select ten time periods and take equal amount of culture solution to dilute and plate on SD-T solid medium, serially dilute 5 gradients 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 , each group had 3 replicates, took 100 μl of bacterial solution to plate, and counted single colonies after cultur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a Candidatus Liberibacter asiaticum effector as a target for screening anti-Candidatus Liberibacter asiaticum drugs, and finds that the Candidatus Liberibacter asiaticum flagellum matrix P-ring protein as the effector can cause significant callose deposition, and an inhibitor of the P-ring protein can be used for preventing and treating Candidatus Liberibacter asiaticum, and has a good application prospect in the field of prevention and treatment of Candidatus Liberobacter asiaticum. Meanwhile, the characteristics of small genome, simple culture, short life cycle and stable genetic manipulation of the saccharomyces cerevisiae are utilized, and the saccharomyces cerevisiae is used as a model organism for researching the effector of the bacterium CLas. Candidatus liberobacter asiaticum effector bacterium flagellum matrix P-ring protein is overexpressed in the saccharomyces cerevisiae, so that the inherent physiological function of the saccharomyces cerevisiae is disturbed, the phenotype of the saccharomyces cerevisiae is changed, and the proliferation of saccharomyces cerevisiae cells is inhibited. Meanwhile, transient expression in the Bensi tobacco leaves under agrobacterium tumefaciens mediation verifies and identifies that the gene can induce plant defense reactions such as local allergic necrosis of tobacco leaves and callose deposition.

Description

technical field [0001] The invention relates to the technical field of microorganisms, in particular to the application of an effector of citrus huanglongbing as a drug target for screening anti-citrus huanglongbing. Background technique [0002] Citrus Huanglongbing (Candidatus Liberibacter, Ca.L) belongs to α-Proteobacteria (α-Proteobacteria) Liberibacter, is a phloem obligate parasitic Gram-negative bacteria, the citrus Huanglongbing caused by it is It is one of the important diseases that seriously endanger the production of citrus in the world. Citrus chrysanthemum can infect all citrus varieties and citrus hybrids, including Rutaceae, at all stages of the citrus growth cycle and eventually kill the tree. In the early stage of plant infection, the new shoots and then the new leaves turn chlorotic and yellow, the leaves are mottled with yellow and green, and the stripes on both sides of the midrib are asymmetrical, similar to the symptoms of nutrient deficiency. After ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/82A01H5/12A01H6/82C12Q1/02A01N61/00A01P1/00C12R1/865
CPCC12N15/81C12N15/8239C07K14/195C12Q1/025A01N61/00
Inventor王俊霞左思靓吴思丰谭文岚江美倩徐领会周筱帆张炼辉
OwnerSOUTH CHINA AGRI UNIV