Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing 5-aminolevulinic acid through fermentation

A technology of aminolevulinic acid and fermentation medium, applied in the field of bioengineering, can solve the problems of low yield of target product, the yield of 5-aminolevulinic acid needs to be further improved, the production performance of bacterial strains and the like, so as to improve the synthesis effect, improve the Extracellular secretion capacity, the effect of increasing the accumulation amount

Pending Publication Date: 2021-12-31
XINTAI JIAHE BIOTECH CO LTD +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The main problem of the production of ALA by the above-mentioned microbial fermentation is that the yield of the target product is low
Moreover, in actual industrialized fermentation production, due to the amplification effect, the production performance of the bacterial strain will be significantly reduced, so that the production of 5-aminolevulinic acid by existing fermentation needs to be further improved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing 5-aminolevulinic acid through fermentation
  • Method for producing 5-aminolevulinic acid through fermentation
  • Method for producing 5-aminolevulinic acid through fermentation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1: Construction of 5-aminolevulinic acid producing bacteria

[0041] (1) The pxpR, PoxB, ptsG, sucC, sucD and pta genes in Bacillus subtilis were knocked out by Red homologous recombination technology to obtain Bacillus subtilis engineering bacteria (Bacillus subtilisΔ pxpRΔ PoxBΔ ptsGΔ sucCΔ sucDΔ pta); the specific process is as follows :

[0042] 1) Construction of the linear target box:

[0043] The knockout plasmid selects pK18mobSacB, which has kanamycin resistance; the homology arm of PoxB and ptsG is 40bp, the homology arm of pta and sucC&D is 35bp, and the homology arm of pxpR is 35bp;

[0044] The homology arm primers corresponding to the knockout of different genes are as follows:

[0045] Pk-pxpR-F: AGATGGAATGGCTGACATAGCAAAGGGGATGAATG; (SEQ ID NO. 5)

[0046] Pk-pxp-R: GTAGCCAATCTTTTCTCTGCTGCGTACATTAACGT. (SEQ ID NO.6)

[0047] Pk-poxB-F: TCTCCTGTGGTATTGAAAAAAGGAAAAAGGAGGATACGTT; (SEQ ID NO. 7)

[0048] Pk-poxB-R: AAAAAACAGGGGCCCTAAGAGCCTTGT...

Embodiment 2

[0087] Embodiment 2: Fermentative production of 5-aminolevulinic acid

[0088] (1) Strain activation:

[0089] Streak-inoculate the 5-aminolevulinic acid-producing bacteria constructed in Example 1 onto an LB plate containing 34 μg / ml Chloramphenicol and 100 μg / ml AMP, and culture at 30° C. for 18-20 hours.

[0090] (2) First-level species cultivation:

[0091] Draw 1 inoculated loop of bacteria from the plate and connect it to the first-level seed shake flask (400mL medium / 2L bottle), culture at 30°C and 220°C for about 15h, until OD 600nm The value is 0.15-0.2 (diluted 100 times), the residual sugar is about 10g / L, and the pH is 6.7-7.0.

[0092] Primary seed medium: 30g / L glucose, 5g / L yeast powder (Angel yeast extract powder FM802), 5g / L urea, 3g / L Na 2 HPO 4 12H 2 O, 3g / L KH 2 PO 4 , 1g / L NH 4 Cl, 2g / L MgSO 4 ·7H 2 O, 0.5g / L NaCl, 20mg / LMnSO 4 ·5H 2 O, 50mg / L FeSO 4 ·7H 2 O, 5mg / L VB1, 0.1mg / L biotin;

[0093] Mix all ingredients, adjust the pH to 6.90 with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for producing 5-aminolevulinic acid by fermentation, which comprises the following steps: (1) inoculating a seed solution of 5-aminolevulinic acid producing bacteria into a fermentation culture medium for fermentation culture, monitoring the residual sugar content of a system in the culture process, and starting to supplement sugar when the residual sugar content of the system is less than or equal to 10g / L; (2) fermenting and culturing until the OD600 value is 0.40-0.50 after the fermentation liquor is diluted by 100 times, adding IPTG (isopropyl-beta-d-thiogalactoside) into the system, and adding glycine at the same time; carrying out induction culture for 30-40 hours under the conditions that the temperature is 30-35 DEG C, the pH value is 6.0-6.5 and the dissolved oxygen is 20-40%; and (3) carrying out bacterium breaking treatment on the culture subjected to induction culture, separating and collecting supernatant, thereby obtaining the culture solution containing the 5-aminolevulinic acid. By adopting the method disclosed by the invention, the industrial production of the 5-aminolevulinic acid can be realized, and the yield of the 5-aminolevulinic acid is obviously improved.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a method for fermenting and producing 5-aminolevulinic acid. Background technique [0002] 5-aminolevulinic acid (ALA), molecular formula C 5 h 9 NO 3 , with a melting point of 149-151°C, is a biosynthetic chlorophyll, heme and vitamin B 12 Precursors of tetrahydropyrrole compounds, such as tetrahydropyrrole compounds, have a wide range of application values ​​in medical and agricultural fields. Its structural formula is as follows: [0003] [0004] There are two main synthetic methods of ALA, chemical synthesis and microbial fermentation. Among them, chemical synthesis is increasingly replaced by microbial fermentation because of its complicated steps, serious pollution, and low product yield. Microbial fermentation method is a method of allowing microorganisms to accumulate ALA in large quantities through the C4 or C5 pathway by mutagenizing strains or recombina...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P13/00C12N15/75C12N15/31C12N1/21C12R1/125
CPCC12P13/005C07K14/32C12N15/75
Inventor 岳明瑞曹华杰谢沛郭永胜滕义卫
Owner XINTAI JIAHE BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com