Gene SmLAC1 and application of gene SmLAC1 in regulation and control of synthesis of procyanidine

A proanthocyanidin and gene technology, which is applied in the fields of genetic engineering and molecular biology, can solve the problems that the mechanism of PA oxidation polymerization is not clear, and the comprehensive understanding of PA polymerization mechanism is in its infancy.

Pending Publication Date: 2022-01-28
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a method for regulating the synthesis of proanthocyanidins by using the Danshen laccase gene SmLAC1 to solve the problem that the flavan-3-ol biosynthesis pathway proposed in the above background technology has been basically clear, but the comprehensive understanding of the PA polymerization mechanism is still in its infancy , especially the mechanism of oxidative polymerization of PA is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene SmLAC1 and application of gene SmLAC1 in regulation and control of synthesis of procyanidine
  • Gene SmLAC1 and application of gene SmLAC1 in regulation and control of synthesis of procyanidine
  • Gene SmLAC1 and application of gene SmLAC1 in regulation and control of synthesis of procyanidine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Changes of proanthocyanidin content in salvia miltiorrhiza overexpressing miR397:

[0028] The expression vector pBI121-Ptr-miR397a was transformed into Agrobacterium GV3101 by freeze-thaw method, and a total of 7 transgenic lines were obtained, and the relative expression level of miR397 in the Danshen transgenic lines transfected with pBI121-Ptr-miR397a was detected by fluorescence quantitative PCR changes (such as figure 1 ), the results showed that, compared with the wild-type Salvia miltiorrhiza plants, the expression level of miR397 in the overexpressed Salvia miltiorrhiza plants transformed with pBI121-Ptr-miR397a was significantly increased;

[0029] Proanthocyanidins were extracted by acetone extraction method, extractant: 70% acetone and 0.5% acetic acid, 0.1g of Salvia miltiorrhiza was ground with liquid nitrogen, added the extractant, ultrasonicated in ice water at room temperature for 30 minutes, centrifuged at 10000rpm for 5 minutes, and the precipitate wa...

Embodiment 2

[0039] Clone Danshen laccase SmLAC1 gene and construct Escherichia coli expression vector:

[0040] Firstly, the transcriptomes of miR397-overexpressed Salvia miltiorrhiza and wild Salvia miltiorrhiza were deeply sequenced, and then, according to the screening of differentially expressed genes in flowers, the target gene laccase gene whose expression was significantly decreased in flowers was determined, and the candidate genes were identified by in vitro enzyme activity identification function;

[0041] The prokaryotic expression vector was constructed by enzyme-cut ligation, primers were designed using primer premier 5.0 (PP5), and designed according to the recommendations of the PP5 software. When designing the primers, restriction sites were added to the primers at both ends of the full-length SmLAC1 (indicated by underline );

[0042] F: GCGGCCGC ATGGAGCGCTCTTTGATGTTTTCAGCATG, as shown in SEQ ID NO.3;

[0043] R: GGATCC GCACTTGGGAAAATCAGCCGGCGGCGG, as shown in SEQ ID ...

Embodiment 3

[0059] In the prokaryotic system, it was verified that the SmLAC1 protein can catalyze the function of flavan-3-ol:

[0060] Expression of SmLAC1 gene in prokaryotic E. coli

[0061] The prokaryotic expression vector pET30a-SmLAC1 was transformed into the Escherichia coli Rosetta2 (DE3) strain by chemical transformation to obtain the Escherichia coli strain containing the target gene, and the empty plasmid was transformed at the same time as a negative control. Grow overnight at 37°C on prime LB solid medium, and select positive clones for subsequent experiments;

[0062] Then pick positive single clones and grow overnight at 37°C in 2 mL of LB liquid medium containing 100 mg / L kanamycin, and then inoculate into 50 mL of LB liquid medium containing 100 mg / L kanamycin, 37 Cultivate the OD600 to 0.5 at ℃, add IPTG with a final concentration of 0.1-0.5mM for induction, 20℃-25℃, 150-180rpm, after induction for 8-12h, place the induced cultured bacterial solution in a 4℃ refrigera...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene SmLAC1, which is a salvia miltiorrhiza laccase gene, and the sequence of the salvia miltiorrhiza laccase gene SmLAC1 is as shown in SEQ ID NO. 1; the sequence of the SmLAC1 protein is as shown in SEQ ID NO. 2; an expression vector carrying the SmLAC1 is transformed into a living body, so that the content of procyanidine in a plant body can be increased; and organisms comprise microorganisms and plants, and the proanthocyanidins are dimers of proanthocyanidins B1, B2 and B3. The gene is cloned from a salvia miltiorrhiza plant for the first time, and the encoded protein can catalyze flavan-3-ol to polymerize into the procyanidine, has application value in the aspect of production of effective active substances, provides a new way for large-scale production of the procyanidine, and also lays a solid foundation for industrial production of other related procyanidine.

Description

technical field [0001] The invention relates to the technical fields of genetic engineering and molecular biology, specifically the gene SmLAC1 and its application in regulating the synthesis of proanthocyanidins. Background technique [0002] Proanthocyanidins have physiological functions for plants such as UV resistance, disease resistance, insect resistance, free radical scavenging, regulation of seed dormancy and germination, and affect the quality traits of crops such as palatability, digestibility, and health care value. Proanthocyanidin extract has many medical values, and can be used for anti-aging, prevention and treatment of cardiovascular diseases, prevention and treatment of tumors, etc. Due to its health care and medical effects, it has been widely used in the fields of food, medicine and cosmetics. [0003] Proanthocyanidins are oligomers or polymers of flavan-3-ol monomers, such as catechin and epicatechin. Each molecule of proanthocyanidin consists of a star...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N15/70C12N15/82A01H5/00A01H6/00
CPCC12N9/0061C12Y110/03002C12N15/70C12N15/825
Inventor卢善发李彩丽邱霄霄侯学敏李东巧
OwnerINST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI