Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ELISA detection kit for detecting African swine fever virus antibody and application of protein L

A technology of African swine fever virus and detection kit, which is applied in the field of immune detection, can solve the problems that there is no P72 full-length trimer protein preparation detection kit, and the difficulty of preparing P72 full-length trimer protein, etc. The effects of wide application, stable reaction results and high reaction sensitivity

Inactive Publication Date: 2022-03-01
CHINA AGRI UNIV +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, due to the difficulty in preparing P72 full-length trimer protein, commercially available indirect ELISA kits based on P72 protein all use P72 truncation, and there is no report on the application of P72 full-length trimer protein to prepare detection kits.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: Preparation of African swine fever virus P72 trimeric protein

[0036] 1. Preparation of African swine fever virus P72 trimer recombinant expression strain

[0037] In the present invention, the p72 protein sequence is designed based on the three-dimensional conformation of the P72 protein through bioinformatics and structural biology methods, and the p72 (strep-tag) gene sequence of the African swine fever virus is synthesized by a chemical synthesis method. The p72 gene, yeast GAL1 promoter and ADH1 terminator were constructed on the plasmid to form the P72 protein gene expression cassette. The P72 protein gene expression cassette with homologous recombination arms was amplified by PCR as a repair template. Using CRISPR-Cas9 technology, the gRNA that recognizes GGATTTAGGAATCCATAAAA was co-expressed, and the P72 protein gene expression cassette was inserted into the multi-copy Ty2 retrotransposon of Saccharomyces cerevisiae through homologous recombinati...

Embodiment 2

[0048] Embodiment 2: the establishment of the indirect ELISA kit of detection African swine fever virus antibody of the present invention

[0049] 1. Determination of the optimal coating concentration

[0050] Coat the purified recombinant P72 trimeric protein with 1 µg / mL, 2.5 µg / mL, 5 µg / mL and 10 µg / mL respectively, and coat 96-well microtiter plates at 4 °C overnight at 100 µL / well, and wash with PBST the next day 3 times, then use 1 % BSA as blocking solution, 200 µL / well, block for 2 h at 37 °C, use ASFV antibody-positive serum samples as primary antibodies, and ASFV antibody-negative serum samples as negative controls, incubate at 37 °C for 30 min, wash with PBST Plate 3 times and pat dry; add 1:8000 diluted enzyme conjugate, incubate at 37 ℃ for 30 min, wash plate 3 times with PBST and pat dry; Stop the reaction with the stop solution, and read the OD of each well with a microplate reader 450nm , calculate the P / N value, and determine the optimal coating concentratio...

Embodiment 3

[0064] Embodiment 3: the indirect ELISA kit that detects African swine fever virus antibody based on African swine fever virus P72 trimer

[0065] 1. Determination of the preparation process of the indirect ELISA detection kit

[0066] The indirect ELISA kit that detects African swine fever virus antibody is prepared by the following steps, and its steps are as follows:

[0067] (1) Coating: Coat the ELISA plate with the recombinant African swine fever virus P72 trimer protein, the coating concentration is 5ug / ml, the dosage is 100uL / well, coat overnight at 4°C, wash 3 times with PBST the next day, Pat dry.

[0068] (2) Blocking: block with 1% BSA, 200uL / well, incubate at 37°C for 2h, wash with PBST 3 times, and then spin dry. Dry at 37°C for 2 hours, then vacuum seal for later use.

[0069] 2. Determination of the operation steps of the indirect ELISA detection method

[0070] (1) Dilute the serum to be tested with serum diluent, add it to the coated plate, add 100uL to e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of immunodetection, and discloses an ELISA detection kit for detecting an African swine fever virus antibody. According to the present invention, the protein L enzyme conjugate and the ELISA plate coated with the African swine fever virus capsid protein P72 tripolymer are combined to prepare the ELISA detection kit for detecting the African swine fever virus antibody, and the kit can rapidly and specifically detect the African swine fever virus antibody in serum, has characteristics of extremely high reaction sensitivity, high sensitivity, and good specificity, and can be used for rapidly and specifically detecting the African swine fever virus antibody in serum. The method is simple and convenient to operate, low in cost, stable in reaction result, suitable for monitoring and checking the African swine fever of swinery in large-scale breeding, and easy for large-scale popularization and application.

Description

technical field [0001] The application relates to the technical field of immunoassay, in particular to an ELISA detection kit for detecting African swine fever virus antibody and the application of protein L. Background technique [0002] African swine fever (ASF) is an acute and severe infectious disease of pigs caused by African swine fever virus (ASFV). Clinically, the disease can cause symptoms such as high fever, reticuloendothelial system hemorrhage, and visible mucous membrane redness in pigs. The disease course of pigs infected by strong virus strains is short, and the mortality rate is as high as 100%. [0003] ASFV is an enveloped, double-stranded DNA virus with a complex multilayered structure. Its 5-layer structure from the inside to the outside is the nucleus, the core shell, the inner membrane, the capsid and the outer capsule. African swine fever virus can encode more than 200 proteins, of which the main component of the capsid, P72 protein, accounts for abo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68
CPCG01N33/6893Y02A50/30
Inventor 孟赓步志高赵东明朱文壮张跃平刘文兴刘任强
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com