ELISA detection kit for detecting African swine fever virus antibody and application of protein L
A technology of African swine fever virus and detection kit, which is applied in the field of immune detection, can solve the problems that there is no P72 full-length trimer protein preparation detection kit, and the difficulty of preparing P72 full-length trimer protein, etc. The effects of wide application, stable reaction results and high reaction sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0035] Embodiment 1: Preparation of African swine fever virus P72 trimeric protein
[0036] 1. Preparation of African swine fever virus P72 trimer recombinant expression strain
[0037] In the present invention, the p72 protein sequence is designed based on the three-dimensional conformation of the P72 protein through bioinformatics and structural biology methods, and the p72 (strep-tag) gene sequence of the African swine fever virus is synthesized by a chemical synthesis method. The p72 gene, yeast GAL1 promoter and ADH1 terminator were constructed on the plasmid to form the P72 protein gene expression cassette. The P72 protein gene expression cassette with homologous recombination arms was amplified by PCR as a repair template. Using CRISPR-Cas9 technology, the gRNA that recognizes GGATTTAGGAATCCATAAAA was co-expressed, and the P72 protein gene expression cassette was inserted into the multi-copy Ty2 retrotransposon of Saccharomyces cerevisiae through homologous recombinati...
Embodiment 2
[0048] Embodiment 2: the establishment of the indirect ELISA kit of detection African swine fever virus antibody of the present invention
[0049] 1. Determination of the optimal coating concentration
[0050] Coat the purified recombinant P72 trimeric protein with 1 µg / mL, 2.5 µg / mL, 5 µg / mL and 10 µg / mL respectively, and coat 96-well microtiter plates at 4 °C overnight at 100 µL / well, and wash with PBST the next day 3 times, then use 1 % BSA as blocking solution, 200 µL / well, block for 2 h at 37 °C, use ASFV antibody-positive serum samples as primary antibodies, and ASFV antibody-negative serum samples as negative controls, incubate at 37 °C for 30 min, wash with PBST Plate 3 times and pat dry; add 1:8000 diluted enzyme conjugate, incubate at 37 ℃ for 30 min, wash plate 3 times with PBST and pat dry; Stop the reaction with the stop solution, and read the OD of each well with a microplate reader 450nm , calculate the P / N value, and determine the optimal coating concentratio...
Embodiment 3
[0064] Embodiment 3: the indirect ELISA kit that detects African swine fever virus antibody based on African swine fever virus P72 trimer
[0065] 1. Determination of the preparation process of the indirect ELISA detection kit
[0066] The indirect ELISA kit that detects African swine fever virus antibody is prepared by the following steps, and its steps are as follows:
[0067] (1) Coating: Coat the ELISA plate with the recombinant African swine fever virus P72 trimer protein, the coating concentration is 5ug / ml, the dosage is 100uL / well, coat overnight at 4°C, wash 3 times with PBST the next day, Pat dry.
[0068] (2) Blocking: block with 1% BSA, 200uL / well, incubate at 37°C for 2h, wash with PBST 3 times, and then spin dry. Dry at 37°C for 2 hours, then vacuum seal for later use.
[0069] 2. Determination of the operation steps of the indirect ELISA detection method
[0070] (1) Dilute the serum to be tested with serum diluent, add it to the coated plate, add 100uL to e...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap