Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for enhancing cold resistance of plants or cultivating high-cold-resistance plants

A kind of cold resistance and plant technology, applied in the direction of botany equipment and methods, angiosperm/flowering plants, biochemical equipment and methods, etc., to achieve the effect of reducing damage, preventing and damage, and enhancing plant cold resistance

Active Publication Date: 2022-05-13
SOUTH CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have reported that NAC transcription factors are involved in the cold response regulatory pathways of various plants, but so far, there have been no reports on the NAC transcription factors of dragon fruit in response to low temperature stress

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for enhancing cold resistance of plants or cultivating high-cold-resistance plants
  • Method for enhancing cold resistance of plants or cultivating high-cold-resistance plants
  • Method for enhancing cold resistance of plants or cultivating high-cold-resistance plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The identification of embodiment 1 dragon fruit NAC-related genes

[0041] 1. Experimental method

[0042] 1. Screening and cluster analysis of dragon fruit NAC-related genes

[0043] The NAM conserved domain model PF02365 was downloaded from the Pfam database, and all possible NAC transcription factor sequences were identified in the dragon fruit genome by using HMMER, and they were classified as HuNAC family genes. The Pfam database was integrated, and the sequences that did not contain the NAC conserved domain or the incomplete domain were removed. Finally, 64 NAC genes were identified from the dragon fruit genome database, and the first gene on chromosome 1 was named HuNAC1~HuNAC64 ( Table 1).

[0044] Download Arabidopsis thaliana (102) NAC protein sequences and dragon fruit NAC protein sequences from TAIR (https: / / www.arabidopsis.org / ) for multiple sequence alignment, and the parameters are set to default; the comparison results are performed with MEGAX software...

Embodiment 2

[0052] Example 2 Cloning of HuNAC20 and HuNAC25 New Genes

[0053] 1. Extraction of total RNA from young stems of dragon fruit and synthesis of the first strand of cDNA

[0054] 1. Experimental method

[0055] Use the EASYspin Plus Plant RNA Rapid Extraction Kit (RN53) (Aidlab, China) to extract the total RNA from the young stems of red-skinned and white-fleshed dragon fruit (refer to the manual for specific methods), and take 2 μL of RNA solution and place it on a nucleic acid analyzer to detect RNA The concentration and purity of the samples were tested by electrophoresis on 1% agarose gel, and qualified samples were used for the next experiment.

[0056] Eligible samples were reverse-transcribed from total RNA into cDNA using the PrimeScriptTM RT reagent Kit with gDNA Eraser (TaKaRa, Japan) reverse transcription kit. For specific operations, refer to the instructions. The cDNA was tested by the dragon fruit internal reference gene Actin and stored at -20°C for later use. ...

Embodiment 3

[0075] Example 3 Expression patterns of dragon fruit HuNAC20 and HuNAC25 genes at low temperature

[0076] 1. Experimental method

[0077] In order to explore the expression pattern of NAC genes in dragon fruit, this study used RT-qPCR to analyze the expression levels of HuNACs at different times under low temperature stress.

[0078] For the extraction of total RNA and the method of reverse transcription of total RNA into cDNA, refer to Example 2 of this specification. RT-qPCR primers were designed (quantitative upstream and downstream primers of HuNAC20 gene are shown in SEQ ID NO.17-18; quantitative upstream and downstream primers of HuNAC25 gene are shown in SEQ ID NO.19-20). The primer information is as follows:

[0079] SEQ ID NO. 17: GAGTATCGCCTCGCTAATGTC;

[0080] SEQ ID NO. 18: TGTTGCCCTTCTTGTTGTAGAT;

[0081] SEQ ID NO. 19: TTGGTGTTTTTATCGGAATCG;

[0082] SEQ ID NO. 20: GCATTGTTTTTCTCCCTTGTTC.

[0083] Using the cDNA of each period at a low temperature of 5°C a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for enhancing the cold resistance of plants or cultivating high-cold-resistance plants. Two pitaya genes responding to low-temperature stress are cloned for the first time and are members of an NAC gene family, the lengths of the two pitaya genes are 819bp, and the number of coded amino acids is 272. Through heterologous expression of the two new genes, the low-temperature damage degree of a transgenic plant is obviously lower than that of a wild type plant, and the survival rate of an overexpression strain is obviously higher than that of the wild type plant; the cold resistance of the transgenic plant is enhanced by reducing the ion permeability and reducing the accumulation of malonaldehyde, hydrogen peroxide and superoxide anions, which indicates that the transgenic plant has the function of enhancing the cold resistance of the plant. In production, the plant cold-resistant strain has a wide application prospect in enhancing the cold resistance of plants and has a great application value; when the gene is used for plant variety improvement, the damage of low temperature to plants can be effectively prevented and reduced, and the yield and economic benefits are improved.

Description

technical field [0001] The invention relates to the technical field of plant breeding, in particular to a method for enhancing cold resistance of plants or cultivating plants with high cold resistance. Background technique [0002] Dragon fruit, also known as red dragon fruit, fairy fruit, lover fruit, etc., is a cultivar of the genus Hylocereus or Selenicereus of the family Cactaceae. It is native to Central America and is a tropical and subtropical species. One of the famous and high-quality fruits. Dragon fruit is a tropical and subtropical fruit that has emerged in recent years. It is favored by growers and consumers because it is easy to grow, unique in shape, good in flavor, rich in betalain and other nutrients. [0003] As a tropical and subtropical fruit tree, dragon fruit has poor cold resistance and is easily affected by low temperature chilling injury or freezing injury. In South China, periodic low-temperature frosts will lead to a reduction in production and q...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/84C12N1/21A01H5/10A01H5/00A01H6/82A01H6/20
CPCC07K14/415C12N15/8273C12N15/8205
Inventor 秦永华胡兴隆胡桂兵张志珂赵杰堂
Owner SOUTH CHINA AGRI UNIV