Application of TaSBE I gene in promoting wheat starch synthesis
A technology of wheat starch and genes, applied in the field of genetic engineering, can solve the problems affecting the degree of crystallization, gelatinization characteristics and expansibility, affecting the structure of amylopectin branch clusters, affecting the quality of pasta products, etc., so as to improve the cooking quality and increase Effect of number of branches, increased swelling potential and gelatinization properties
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Construction of TaSBE I overexpression vector
[0033] 1. According to the map of pMWB172 carrier (provided by Ye Xingguo Laboratory, Chinese Academy of Agricultural Sciences), design the upstream primer TaSBE I-F and downstream primer TaSBE I-R of TaSBE I, and the nucleotide sequence of the upstream primer TaSBEI-F is as shown in SEQ ID NO.2, Specifically: 5'-TGCAGGTCGACTCTAGAGGA TCCCCGGG(Sma I)ATGCTCTGCCTCACCGCCCCCT-3'; the nucleotide sequence of the downstream primer TaSBE I-R is shown in SEQ ID NO.3, specifically: 5'-CGGGGAAATTCGAGCTCTCTAGAACTAGT(Spe I)TTATTTGTTGTCTTTGTCGGGT -3'. Using the cDNA of Zhengmai 7698 as the template, PCR amplification was carried out using the above primers (98°C, 5min pre-denaturation; then 98°C denaturation for 10s, 53°C annealing for 5s, 72°C extension for 20s, a total of 35 cycles; 72°C final extension 7min ; 16 ℃, storage), after the amplification, perform agarose gel electrophoresis to detect the size of the amplified band, the res...
Embodiment 2
[0036] Acquisition and Identification of TaSBE I Transgenic Wheat Plants
[0037] (1) Acquisition of TaSBE I transgenic wheat plants
[0038] Wheat embryos were transformed by biolistic method. The specific process is as follows: first, select the young ears of wheat after flowering, and culture them in low temperature hydroponics for about 1 week; separate the wheat seeds and sterilize them; use sterilized tweezers and scalpels to peel off the young embryos of wheat, and place them in a petri dish for use . At the same time, the overexpression vector pMWB172-TaSBE I in Example 1 was bombarded with the immature embryos of wheat by the gene gun; the culture process of the immature wheat embryos after bombardment was as follows: 6 Induction medium (containing MS macroelements, MS microelements, 2,4-D, vitamin B5, etc.) was cultured in the dark at 25°C; then callus-producing immature embryos were transferred to differentiation medium (containing MS, 2, 4-D, MEG, G418, etc.) at...
Embodiment 3
[0043] (1) Effects of TaSBE I gene on starch content and 1000-grain weight of wheat grains
[0044] Transgenic lines 1 to 3 of Example 2 were planted individually, and their thousand-grain weight and starch content were measured at the harvest period. The results are shown in Table 1.
[0045] Table 1 1000-grain weight and starch content of transgenic plants
[0046]
[0047] Note: TaSBE I-OE1, TaSBE I-OE2, TaSBE I-OE3 represent transgenic lines 1-3 of Example 2; WT represents Zhengmai 7698.
[0048] According to Table 2, it can be seen that the 1000-grain weight of wheat grains increased by 8.16%, 12.51% and 8.78%, the total starch content increased by 3.53%, 2.80% and 3.75%, and The increase of amylopectin content was 5.14%, 4.27% and 5.27%, respectively. The thousand-kernel weight, total starch content and amylopectin content of transgenic wheat were significantly higher than those of wild-type (WT) wheat Zhengmai 7698; and transgenic wheat The amylose content of the t...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com