Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of TaSBE I gene in promoting wheat starch synthesis

A technology of wheat starch and genes, applied in the field of genetic engineering, can solve the problems affecting the degree of crystallization, gelatinization characteristics and expansibility, affecting the structure of amylopectin branch clusters, affecting the quality of pasta products, etc., so as to improve the cooking quality and increase Effect of number of branches, increased swelling potential and gelatinization properties

Active Publication Date: 2022-07-29
HENAN AGRICULTURAL UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The non-random distribution of linear chains and the regular order of branched clusters require specific lengths of A and B chains, and this structural difference will lead to differences in the crystal structure of starch granules, further affecting the amylopectin branched clusters. The structure of starch in wheat grains ultimately affects the degree of crystallization, gelatinization properties and expansibility of wheat grains (BagaM, Glaze S, Mallard CS, et al. A starch branching enzyme gene in wheat produce salt alternatively spliced ​​transcripts. Plant Molecular Biology, 1999, 40:1019-1030; Mohan B H, Malleshi N G.Characteristics of native and enzymatically hydrolyzed common wheat(Triticum aestivum)and dicoccum wheat(Triticum dicoccum) starches[J].European Food Research and Technology,2006,223(3):355 -361.), thus affecting the quality of pasta products
However, there are almost no reports on the synthesis of wheat starch, and most of them only speculate on its function and have not been effectively verified.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of TaSBE I gene in promoting wheat starch synthesis
  • Application of TaSBE I gene in promoting wheat starch synthesis
  • Application of TaSBE I gene in promoting wheat starch synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Construction of TaSBE I overexpression vector

[0033] 1. According to the map of pMWB172 carrier (provided by Ye Xingguo Laboratory, Chinese Academy of Agricultural Sciences), design the upstream primer TaSBE I-F and downstream primer TaSBE I-R of TaSBE I, and the nucleotide sequence of the upstream primer TaSBEI-F is as shown in SEQ ID NO.2, Specifically: 5'-TGCAGGTCGACTCTAGAGGA TCCCCGGG(Sma I)ATGCTCTGCCTCACCGCCCCCT-3'; the nucleotide sequence of the downstream primer TaSBE I-R is shown in SEQ ID NO.3, specifically: 5'-CGGGGAAATTCGAGCTCTCTAGAACTAGT(Spe I)TTATTTGTTGTCTTTGTCGGGT -3'. Using the cDNA of Zhengmai 7698 as the template, PCR amplification was carried out using the above primers (98°C, 5min pre-denaturation; then 98°C denaturation for 10s, 53°C annealing for 5s, 72°C extension for 20s, a total of 35 cycles; 72°C final extension 7min ; 16 ℃, storage), after the amplification, perform agarose gel electrophoresis to detect the size of the amplified band, the res...

Embodiment 2

[0036] Acquisition and Identification of TaSBE I Transgenic Wheat Plants

[0037] (1) Acquisition of TaSBE I transgenic wheat plants

[0038] Wheat embryos were transformed by biolistic method. The specific process is as follows: first, select the young ears of wheat after flowering, and culture them in low temperature hydroponics for about 1 week; separate the wheat seeds and sterilize them; use sterilized tweezers and scalpels to peel off the young embryos of wheat, and place them in a petri dish for use . At the same time, the overexpression vector pMWB172-TaSBE I in Example 1 was bombarded with the immature embryos of wheat by the gene gun; the culture process of the immature wheat embryos after bombardment was as follows: 6 Induction medium (containing MS macroelements, MS microelements, 2,4-D, vitamin B5, etc.) was cultured in the dark at 25°C; then callus-producing immature embryos were transferred to differentiation medium (containing MS, 2, 4-D, MEG, G418, etc.) at...

Embodiment 3

[0043] (1) Effects of TaSBE I gene on starch content and 1000-grain weight of wheat grains

[0044] Transgenic lines 1 to 3 of Example 2 were planted individually, and their thousand-grain weight and starch content were measured at the harvest period. The results are shown in Table 1.

[0045] Table 1 1000-grain weight and starch content of transgenic plants

[0046]

[0047] Note: TaSBE I-OE1, TaSBE I-OE2, TaSBE I-OE3 represent transgenic lines 1-3 of Example 2; WT represents Zhengmai 7698.

[0048] According to Table 2, it can be seen that the 1000-grain weight of wheat grains increased by 8.16%, 12.51% and 8.78%, the total starch content increased by 3.53%, 2.80% and 3.75%, and The increase of amylopectin content was 5.14%, 4.27% and 5.27%, respectively. The thousand-kernel weight, total starch content and amylopectin content of transgenic wheat were significantly higher than those of wild-type (WT) wheat Zhengmai 7698; and transgenic wheat The amylose content of the t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of a TaSBEI gene in promoting wheat starch synthesis. The TaSBEI gene can improve the starch content and thousand seed weight of wheat grains, influence the chain length distribution of wheat amylopectin, improve the branching degree of the grain amylopectin, increase the branch number of the wheat amylopectin, and facilitate the improvement of the related cooking quality of the wheat grain amylopectin.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to the application of TaSBEI gene in promoting wheat starch synthesis. Background technique [0002] Wheat (Triticum aestivum L.) provides food for about 1 / 3 of the world's population and is one of the most important food crops in the world (He M, Zhu C, Dong K, et al. Comparative proteome analysis of embryo and endosperm reveals central differential expression proteins involved in wheat seed germination [J]. BMC Plant Biology, 2015, 15(1): 1-17.). Starch is the main component of wheat grains, accounting for about 75% of the total components of wheat grains; starch mainly exists in the form of carbohydrates, providing human beings with daily energy. The starch content, type (amylose, amylopectin, ratio of amylose to amylopectin) and physical and chemical properties (gelatinization characteristics, swelling potential) all affect the appearance and taste of pasta products...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/10A01H6/46
CPCC07K14/415C12N15/8245C12N15/8261
Inventor 李鸽子康国章王鹏飞柳海涛韩巧霞刘国芹葛强
Owner HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com