Antibacterial peptide gene of Chinese prawn and its colon technique
A Chinese prawn and antimicrobial peptide technology, applied in the field of molecular biology, can solve the problem that the research on antimicrobial peptides has not yet been reported.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0094] Embodiment 1. A cloned Chinese prawn antimicrobial peptide gene has the following sequence:
[0095] sequence listing
[0096] Homologous gene one:
[0097] (1) Information of SEQ ID N0 1
[0098] (a) Sequence features:
[0099] *Length: 600 bp
[0100] *Type: nucleic acid
[0101] * Chain type: double chain
[0102] *Topology: Linear
[0103] (b) Molecular type: cDNA
[0104] (c) Assumption: No
[0105] (d) Antisense: no
[0106] (e) Original source: Prawns (Penaeus chinensis)
[0107] (f) Sequence description: SEQ ID NO.1
[0108]ATGCGCCTCGTGGTCTGCCTGGTCTTCTTGGCCTCCTTCGCCCTGGTCTGCCAAGGGCAA 60
[0109] AAGGGTGGTTACACACGCCCGATATCCAGACCACCCTATGGGGGAGGATATGGCAATGTT 120
[0110] TGCACTTCATGCCACGTTTCTTACCACCTCACAAGCTCGTTCTTGCTGCAGTCGGTTTGGA 180
[0111] CGTTGCTGTGTGCCAAGAAGAGGATACAGTGGTTGATGAAGAAGACAACGAAAACCTGAC 240
[0112] TTCACAACGTATTCATTATTGTGAAGAGACTGCAACCCTGATTTTGAACTGTATTTTCT 300
[...
Embodiment 2
[0130] Embodiment 2. Cloning method of Chinese prawn antimicrobial peptide gene
[0131] 1. Extraction of total RNA: extract hemolymph from the abdominal sinus of the base of the first abdominal segment of Chinese prawns over 10 cm in length, add 1 / 10 volume of anticoagulant (10% sodium citrate, pH7) and 200 μM phenyl Thiourea (as melanization inhibitor). 30 ml of hemolymph was centrifuged at 700g for 15 minutes at 4°C to collect blood cells. The collected blood cells were extracted with Nippon Takara Biotechnology RNA extraction kit Catrimox TM Extract total RNA.
[0132] 2. cDNA first-strand synthesis: about 30 micrograms of total RNA, plus 20 microliters of reaction solution (50 millimoles potassium chloride, 3 millimoles magnesium chloride, 10 millimoles tris-hydrochloric acid buffer (Tris-HCl ) pH 8.3, 1 millimolar dithiothreitol (DTT), 5 micromolar oligodeoxythymonucleotide (Oligod(T)17), 500 micromolar deoxyribonucleotide mixture (dNTP), 25 units of RNA Enzyme inhib...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More