Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing interferon

An interferon and fermentation test technology, applied in the field of preparing α1b type interferon, can solve the problems of low expression level, incorrect expression amount, low fermentation density, etc., and achieves the effects of improved expression level, simplified method and good repeatability

Inactive Publication Date: 2003-10-29
SHANGHAI INST OF BIOLOGICAL PROD CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the early 1980s, Hou Yunde of the Institute of Virology of the Academy of Medical Sciences cloned the α1b interferon gene for the first time, and established the expression plasmid and engineering bacteria pBV867 / BMH71-18 in 1984. From the perspective of the α1b interferon engineering bacteria, The expression level of the earliest constructed pBV867 / BMHt71-18 is very low, and the expression level of α1b interferon is less than 1% of the total bacterial protein, which is difficult to apply to large-scale production
[0004] The purification of recombinant proteins has always been a difficult problem. In order to make the final product meet the relevant standards, multiple methods and multiple steps must be used to achieve the goal, which will inevitably affect the final yield of the product
At present, due to the low expression of recombinant α1b-type interferon engineering strains, low fermentation density, and complicated purification process, the production of interferon is low and the production cost is high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing interferon
  • Method for preparing interferon
  • Method for preparing interferon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 Alteration of Partial Sequence of Human α1b-type Interferon Gene

[0018] For the codon optimization of the coding gene in Escherichia coli, and the secondary structure of the expression plasmid TIR, the following changes were made, and at least one site of the mutation site was changed to produce the same effect. 1) Perform synonymous mutations on the nucleotide sequence encoding the 12th, 13th, 14th, and 15th amino acids of the N-terminal of α1b interferon, and the nucleotide sequences are changed from AGG, AGG, ACC, TTG to CGT, CGT, ACT, CTG.

[0019] The mutated α1b interferon gene was correct after the complete sequence analysis, and it was named α1bM. The synthetic primer: 5'CCAGGAGCATCAGAGTACGACGGTTATCCAGGC3' was phosphorylated with T4 polynucleotide kinase according to the conventional method in this field, and the 12th, 13th, 14th, and 15th positions of the N-terminal Amino acid nucleotides were site-specifically changed, and the above-mentioned muta...

Embodiment 2

[0022] Example 2 Construction of α1bM2 gene interferon expression plasmid and its expression

[0023] 1) Prokaryotic expression plasmid expressing α1b interferon from T7 promoter

[0024] The α1bM2 gene PCR product was digested with NdeI and BamHI, inserted into the PET plasmid with T7 promoter digested by NdeI and BamHI, and transformed into Escherichia coli DH5α. It was proved by enzyme digestion that the α1bM2 gene had been inserted into the PET plasmid, and the plasmid was named pEAM2.

[0025] 2) The expression plasmid is expressed in Escherichia coli

[0026] Known engineered bacteria

[0027]

Embodiment 3

[0028] Example 3 High-density fermentation and purification of engineering bacteria in a fermenter

[0029] Large-scale fermentation: pick a single colony into the LB medium containing 50 μg / ml kanamycin, shake and cultivate overnight at 37°C, transfer to 6000ml LB medium containing 50μg / ml, shake and culture at 37°C for 4 hours until OD600 to 0.6 Transfer to a 300L fermenter with 150L fermentation medium, set certain conditions, and add nutrients. When the culture reaches OD600 to about 10, add lactose to induce culture for 6 hours, and collect the bacteria by centrifugation. SDS-PAGE electrophoresis scanning proves that the expression of interferon accounts for 30% of the soluble bacteria, which is more than 10 times higher than that of the original strain in the same volume of fermentation.

[0030] The fermentation medium contains (gram / liter): KH 2 PO 4 0.5-2.5,K 2 HPO 4 ·3H 2 O0.5-2.5, MgSO4 ·7H 2 O2.0-5.0, (NH 4 ) 2 SO 4 0.5-3.0, Yeast extract2.0-6.04, PPE0.15 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A process for preparing the alpha-16 interferon includes optimizing the gene sequence of alpha-16 interferon, choosing proper expression system, reconstructing the engineering bacterial strain able to effectively express it, and creating the fermenting and purifying technology with galactose or lactose. Its advantages are high yield, high expression and low cost.

Description

technical field [0001] The invention belongs to the field of biological technology and relates to a method for preparing interferon, in particular to a method for preparing α1b type interferon. Background technique [0002] Interferon (Interferon, IFN) is a small molecular polypeptide secreted by cells with various biological activities. It has broad-spectrum anti-virus, anti-tumor and immune regulation and other biological activities. As one of the therapeutic agents, it is the first cytokine that has been produced in large-scale commercial production by genetic engineering technology and has been verified by long-term clinical application. According to the biochemical characteristics of interferon and the different roles it plays in the body's immunity, it is divided into three categories: α, β, and γ. [0003] Goeddel was the first to express interferon with genetic engineering technology in 1980. Since then, various types of IFN have their genetic engineering products. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K1/14C07K14/555C12N15/20C12P21/02
Inventor 徐帆洪吴腾捷
Owner SHANGHAI INST OF BIOLOGICAL PROD CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More