Cotton verticillium wilt germ secreted exciton gene and its application

A residue and amino acid technology, which is applied to the gene of non-specific Verticillium dahliae elicitor and its application field, can solve the problems such as the secretory elicitor gene of Verticillium dahliae that has not been reported.

Inactive Publication Date: 2005-04-27
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] So far, there is no report in the field of cotton Verticillium dahliae secreted elicitor gene, s

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton verticillium wilt germ secreted exciton gene and its application
  • Cotton verticillium wilt germ secreted exciton gene and its application
  • Cotton verticillium wilt germ secreted exciton gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Construction of cDNA library of Verticillium dahliae and release of phage

[0080] 25°C, 150rpm shaking suspension culture Verticillium dahliae (Verticillium dahliae) for 2-3 weeks, when the secretion of its secreted protein reaches the peak, collect the bacteria as material, extract total RNA, use the library construction kit of Stratagene company, A cDNA library of Verticillium dahliae was constructed by the following method.

[0081] A certain amount of the synthesized first- and second-strand cDNA and samples after fractionation were taken for electrophoresis to ensure the quality of cDNA, especially after fractionation, components containing cDNA below 500bp were not used, so as not to affect the connection of large fragments of cDNA efficiency. After the cDNA was connected with the ZAP express vector (Stratagene Company), it was packaged by packaging protein to obtain about 1.0×10 6 Original library of independent clones of Pfu.

[0082] Will XL 1 -Blue compet...

Embodiment 2

[0086] Sequencing and analysis of ESTs sequences

[0087] Single clones were picked and cultured overnight in a 96-well plate with shaking. Plasmids were extracted, and samples were electrophoresed to detect the quality of the plasmids. The T3 primer was used as the sequencing primer and sequenced on a Megabase automatic sequencer. The obtained 1300 DNA sequences were compared in Genebank, and according to the comparison results, they were classified according to the possible functions of the ESTs sequences (the expected value was greater than e-3).

[0088] result:

[0089] Among the 1300 ESTs sequences, there are 35 sequences that determine protein fate; 12 sequences related to protein synthesis; 5 sequences related to cytoskeleton; 24 transport-related proteins; 71 sequences related to signal transduction; 10 related sequences; 52 sequences related to self-defense and host infection; 5 sequences related to DNA metabolism; 17 sequences related to energy metabolism; 229 se...

Embodiment 3

[0096] Prokaryotic expression and purification of VdNEP gene

[0097] (a) Construction of expression vector:

[0098] Forward primer VdNEPEcoRF 5' gaattccagcagccccccaaggtt 3' (SEQ ID NO: 3; containing EcoR I restriction site) and reverse primer VdNEPNotR 5' gcggccgcttaaaacgcggcgcgcatg 3' (SEQ ID NO: 4; containing NotI) for the full-length sequence of VdNEP gene cDNA Restriction site), using the extracted Verticillium dahliae mRNA as a template, after RT-PCR amplification with Pfu polymerase (removing the predicted signal peptide sequence), digestion, and ligation into the pET32a(+) plasmid (Novagen Company), the heat shock method was transferred into Escherichia coli DH5α, positive clones were selected, plasmids were extracted by shaking the bacteria, and verified by sequencing.

[0099] (b) Induced expression:

[0100] The plasmid obtained in step (a) was transformed into Escherichia coli BL21 by heat shock method. Select positive clones and culture them in LB medium conta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention provides non-specific exciton gene VdNEP of Verticillium dahliae capable of causing disease resisting allergic reaction on cotton and other plant and its application. VdNEP protein can induce the expression of Arabidopsis thalianum disease course related gene. Low concentration VdNEP protein can induce suspended cotton cell to synthesize gossypol as phytoalexin, while high concentration VdNEP protein can induce the allergic death of suspended cotton cell. When it is injection to cotton cotyledon, the protein in low concentration may cause allergic necrosis spot and the protein in high concentration may cause cotyledon wilting. Treating mature cotton euphylla with the protein will cause the euphylla dewatering. Applying VdNEP provides new way of improving plant disease resistance and has wide application foreground.

Description

technical field [0001] The invention relates to the field of plant disease-resistant genetic engineering, in particular to a non-specific Verticillium dahliae elicitor gene capable of causing disease-resistant allergic reactions on cotton and other plants and its application. Background technique [0002] Recognition plays a key role in plant-pathogen interactions. Pathogens must identify possible host plants in their living environment, and further identify the special surface characteristics of host plants in order to successfully invade and infect. To successfully infect hosts, pathogens must identify and overcome plant defense responses. At the same time, plants must also recognize various possible pathogens in their living environment and activate their own corresponding defense mechanisms. [0003] Elicitors and their receptors play a very important role in the identification process between plants and pathogens. Elicitor initially only refers to molecules or other s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A01H1/00C07H21/00C07K14/195C07K16/12C12N15/11C12N15/31C12N15/63
Inventor 陈晓亚王建营姜卫红林芝萍
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap